ID: 1041383880

View in Genome Browser
Species Human (GRCh38)
Location 8:57279180-57279202
Sequence CTCCGAGAGCTCCGCGTCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041383880_1041383891 27 Left 1041383880 8:57279180-57279202 CCCACGACGCGGAGCTCTCGGAG No data
Right 1041383891 8:57279230-57279252 TGGTGAAAGGGCCATGCAGTCGG No data
1041383880_1041383883 -2 Left 1041383880 8:57279180-57279202 CCCACGACGCGGAGCTCTCGGAG No data
Right 1041383883 8:57279201-57279223 AGCTGGCCAAGATTCCATATCGG No data
1041383880_1041383887 14 Left 1041383880 8:57279180-57279202 CCCACGACGCGGAGCTCTCGGAG No data
Right 1041383887 8:57279217-57279239 ATATCGGACCCTATGGTGAAAGG No data
1041383880_1041383885 7 Left 1041383880 8:57279180-57279202 CCCACGACGCGGAGCTCTCGGAG No data
Right 1041383885 8:57279210-57279232 AGATTCCATATCGGACCCTATGG No data
1041383880_1041383888 15 Left 1041383880 8:57279180-57279202 CCCACGACGCGGAGCTCTCGGAG No data
Right 1041383888 8:57279218-57279240 TATCGGACCCTATGGTGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041383880 Original CRISPR CTCCGAGAGCTCCGCGTCGT GGG (reversed) Intergenic
No off target data available for this crispr