ID: 1041384090

View in Genome Browser
Species Human (GRCh38)
Location 8:57280174-57280196
Sequence GCGCGGTCCCAGCTGTCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 76}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041384090_1041384094 -9 Left 1041384090 8:57280174-57280196 CCCTGAGACAGCTGGGACCGCGC 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1041384094 8:57280188-57280210 GGACCGCGCGCTCGGCTCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 14
1041384090_1041384097 10 Left 1041384090 8:57280174-57280196 CCCTGAGACAGCTGGGACCGCGC 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1041384097 8:57280207-57280229 AGGGAGCTCGGCCAGTCCACAGG 0: 1
1: 0
2: 2
3: 14
4: 109
1041384090_1041384096 -2 Left 1041384090 8:57280174-57280196 CCCTGAGACAGCTGGGACCGCGC 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1041384096 8:57280195-57280217 GCGCTCGGCTCTAGGGAGCTCGG 0: 1
1: 0
2: 0
3: 8
4: 88
1041384090_1041384093 -10 Left 1041384090 8:57280174-57280196 CCCTGAGACAGCTGGGACCGCGC 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1041384093 8:57280187-57280209 GGGACCGCGCGCTCGGCTCTAGG 0: 1
1: 0
2: 0
3: 6
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041384090 Original CRISPR GCGCGGTCCCAGCTGTCTCA GGG (reversed) Intergenic
900893299 1:5465223-5465245 GAGCAGACCCAGCTGTTTCAGGG - Intergenic
902520664 1:17013916-17013938 GCTCCTTCCCAGCTGGCTCAGGG - Intergenic
908424063 1:63988194-63988216 TCCAGGACCCAGCTGTCTCAGGG + Intronic
910757891 1:90710759-90710781 TTGCAGTCCCAGCTGTCCCAGGG + Intergenic
923400726 1:233613877-233613899 GCGCGGTCTCCGCTGACTCTCGG + Intergenic
1063156472 10:3383785-3383807 TCGAGCTCCCATCTGTCTCAAGG - Intergenic
1066148732 10:32591812-32591834 GCGGGCTCCCATCTGTCCCAGGG + Intronic
1067522239 10:47016686-47016708 TCGAAGACCCAGCTGTCTCAAGG - Intergenic
1069784147 10:70977275-70977297 CCACGGTCCCTCCTGTCTCAGGG - Intergenic
1073216620 10:101840085-101840107 GCGCGGACTCAGCCTTCTCAGGG + Intronic
1074772995 10:116745330-116745352 CCACAGCCCCAGCTGTCTCAGGG + Intergenic
1075634280 10:124019755-124019777 GAGGGGTCCCATCTCTCTCAGGG + Intronic
1077407142 11:2387704-2387726 GTGGGGTCCCAGCTGCCACATGG + Intronic
1079128405 11:17734515-17734537 GCGCGGGCCCAGACGTCTCTCGG + Intergenic
1079429065 11:20371246-20371268 GCGAGGTCCTAGCTGGTTCAAGG + Intronic
1083331283 11:61899496-61899518 GCCCAGTCCCAGCTGAGTCAGGG - Intronic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1092960912 12:13596235-13596257 GTGGAGTCCCAGCTGCCTCAGGG + Intronic
1096239246 12:49950792-49950814 GGGCTGGCCCAGCTGTCTCAGGG - Exonic
1102394702 12:112575704-112575726 GCGGGGTCCCAGCCGGCTCCAGG - Intronic
1104655231 12:130569421-130569443 GCTCAGCCCCAGCTTTCTCAAGG - Intronic
1104933942 12:132354683-132354705 GCGCGGTCCCTGGTGGCCCAGGG - Intergenic
1105809296 13:23980212-23980234 CCGCGGCCCCAGCAGGCTCAAGG + Intronic
1109749129 13:66666351-66666373 TCGTGGTTCCAGCTGGCTCAAGG + Intronic
1112853038 13:103730562-103730584 GCGCGGAGCCACCTTTCTCAGGG - Intergenic
1121983794 14:98479253-98479275 GCTCAGTCCCAGTTGTCTCTGGG - Intergenic
1122715839 14:103696653-103696675 CAGCGGGGCCAGCTGTCTCAGGG + Intergenic
1125880520 15:43190061-43190083 GCCCCGTACCAGCTTTCTCAGGG - Exonic
1128614881 15:69101229-69101251 GAGCGCTCCCATCTGGCTCAAGG - Intergenic
1131298487 15:91173328-91173350 GCGTGGTACGAGCTGTGTCAAGG + Intronic
1132299573 15:100767657-100767679 GAGCAGTCCCAGCTGGCTGAGGG + Intergenic
1132850710 16:2023745-2023767 GCAAGGTCCCAGCGATCTCAGGG - Intergenic
1146536524 17:33657389-33657411 GGCCAGTCCCAGCTGCCTCATGG - Intronic
1151670039 17:75567041-75567063 GCCCGGGCTCAGCTGTCCCATGG - Intronic
1152704419 17:81835312-81835334 TCGCGTTCCTAGCTATCTCATGG - Intergenic
1152745756 17:82037858-82037880 GCGGGGTCTCCGCTGCCTCAGGG + Intergenic
1160786191 19:901133-901155 GGGTGGGCCCAGCTGTCTCGGGG + Intronic
1161216916 19:3099234-3099256 GCTGGGTCCCAGCTGTCTACAGG - Intronic
1161514592 19:4689558-4689580 GGGCGGTCCCACCTGGCTCATGG + Exonic
1162259243 19:9518964-9518986 GAGCGGTCCCCGCTGTCCCATGG + Intergenic
1163618087 19:18341255-18341277 GGGCTCTCCCAGCTGTCCCAGGG + Intronic
931617434 2:64174167-64174189 GCCCAGCCCCAGATGTCTCAGGG + Intergenic
938210111 2:129459965-129459987 ACCCTGTCCCAGTTGTCTCAGGG - Intergenic
946437066 2:219664241-219664263 GCGCGGTCCCAGGTCTGGCAGGG + Intergenic
948124056 2:235551918-235551940 GGGCGATCCCAGCTTTCTCCTGG + Intronic
1169315240 20:4584946-4584968 CCATAGTCCCAGCTGTCTCATGG - Intergenic
1172915165 20:38438084-38438106 GCCCGTTCCCAGCTTTCTGAGGG - Intergenic
1175945975 20:62558964-62558986 CCGCGTTCTCAGCTGTCCCATGG + Intronic
1178977698 21:37233714-37233736 GCACGGTCCCACCTGTAGCAGGG + Intronic
1179887377 21:44319942-44319964 GCGCGGTGTCTGCTGCCTCATGG + Intronic
1179977789 21:44879749-44879771 ACACTGTCCCAGCTGTCCCAGGG - Intergenic
1180144614 21:45912361-45912383 GGGCGGACCCAGCTGTTTCCAGG - Intronic
1184686539 22:46098922-46098944 GCAAGGATCCAGCTGTCTCAAGG + Intronic
1185255273 22:49828002-49828024 GCCCGGTCCCCGCCGCCTCAGGG - Intergenic
952809069 3:37385411-37385433 GCCTGATCCCAGCTGTCCCAAGG + Intergenic
954128971 3:48550090-48550112 GCTTGGCCCCAGCTGTCTAAGGG - Intronic
954442485 3:50529461-50529483 GGGTCATCCCAGCTGTCTCAAGG + Intergenic
954624759 3:52016378-52016400 GAGAGGTCCCAGCTGTCGGACGG - Intergenic
962931323 3:140040241-140040263 GCGCAGTGCCATCTGTTTCAGGG - Intronic
968225256 3:196968937-196968959 GCGCGGCCCCAGCTCGCTCCGGG - Intronic
968576259 4:1367647-1367669 GCGAGGTCCCGGCTGGCTCCAGG - Intronic
969339479 4:6531164-6531186 GAGCGGTGCCGGCTGTCTCAGGG - Intronic
978842788 4:113234152-113234174 TGGCATTCCCAGCTGTCTCATGG + Intronic
981576645 4:146212926-146212948 GCGAGGGCCCTGCTGACTCAGGG - Intergenic
993822954 5:92643508-92643530 GCCTGGTCCTAGCTGTCTTATGG + Intergenic
1001285494 5:170420219-170420241 GGGCTGGCCCTGCTGTCTCAGGG - Intronic
1001407929 5:171488962-171488984 GGGTGGCCCCAGCTGCCTCAGGG + Intergenic
1018886182 6:167940123-167940145 GCCCAGTCCCAGATGCCTCATGG - Intronic
1028425044 7:90676833-90676855 GCTCAGTCCCAGATGTTTCAAGG + Intronic
1029682239 7:102119368-102119390 GTGCTGTCCCAGCTGACGCATGG - Intronic
1030114097 7:106050169-106050191 GCCAGGCCCCAGCTGGCTCATGG - Intergenic
1037981956 8:23260782-23260804 GCTTGCTCCCAGCTGTATCATGG + Exonic
1039419491 8:37424090-37424112 CTGCAGTCCCACCTGTCTCAAGG - Intergenic
1041384090 8:57280174-57280196 GCGCGGTCCCAGCTGTCTCAGGG - Intergenic
1049508723 8:143017451-143017473 GCGATGGCCCAGCTGTCTCTGGG - Intergenic
1052855580 9:33404319-33404341 ACACAGTCCCATCTGTCTCACGG + Intergenic
1061993635 9:134173384-134173406 GCGCGGTCACCGCTGTGCCAAGG + Intergenic
1062577438 9:137215236-137215258 CCCCGGTCCCAGCTTTCCCAGGG - Intronic
1203360685 Un_KI270442v1:217715-217737 GCGCGGCCCCGGCTGGCTGAGGG + Intergenic
1190745791 X:53321159-53321181 GCCCTGTCCCCGCTCTCTCACGG + Exonic
1195625064 X:106999334-106999356 CTGCGGACCCAGCTGCCTCAGGG + Intronic