ID: 1041389213

View in Genome Browser
Species Human (GRCh38)
Location 8:57334149-57334171
Sequence AAGGAAGCACAGACGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041389213_1041389216 -4 Left 1041389213 8:57334149-57334171 CCATTCTCCGTCTGTGCTTCCTT No data
Right 1041389216 8:57334168-57334190 CCTTACAGCCATCCCTAGCAAGG No data
1041389213_1041389221 24 Left 1041389213 8:57334149-57334171 CCATTCTCCGTCTGTGCTTCCTT No data
Right 1041389221 8:57334196-57334218 TTTTTGCCCTTTGTAGTCACAGG No data
1041389213_1041389222 28 Left 1041389213 8:57334149-57334171 CCATTCTCCGTCTGTGCTTCCTT No data
Right 1041389222 8:57334200-57334222 TGCCCTTTGTAGTCACAGGATGG No data
1041389213_1041389217 -3 Left 1041389213 8:57334149-57334171 CCATTCTCCGTCTGTGCTTCCTT No data
Right 1041389217 8:57334169-57334191 CTTACAGCCATCCCTAGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041389213 Original CRISPR AAGGAAGCACAGACGGAGAA TGG (reversed) Intergenic
No off target data available for this crispr