ID: 1041389341

View in Genome Browser
Species Human (GRCh38)
Location 8:57335154-57335176
Sequence TCATCTCCATTTACAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041389341_1041389343 -10 Left 1041389341 8:57335154-57335176 CCCTCTTCTGTAAATGGAGATGA No data
Right 1041389343 8:57335167-57335189 ATGGAGATGACAATTCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041389341 Original CRISPR TCATCTCCATTTACAGAAGA GGG (reversed) Intergenic
No off target data available for this crispr