ID: 1041389343

View in Genome Browser
Species Human (GRCh38)
Location 8:57335167-57335189
Sequence ATGGAGATGACAATTCCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041389336_1041389343 23 Left 1041389336 8:57335121-57335143 CCAATTGGAGAAGAGTATTTAAC No data
Right 1041389343 8:57335167-57335189 ATGGAGATGACAATTCCACCTGG No data
1041389335_1041389343 29 Left 1041389335 8:57335115-57335137 CCTGGTCCAATTGGAGAAGAGTA No data
Right 1041389343 8:57335167-57335189 ATGGAGATGACAATTCCACCTGG No data
1041389341_1041389343 -10 Left 1041389341 8:57335154-57335176 CCCTCTTCTGTAAATGGAGATGA No data
Right 1041389343 8:57335167-57335189 ATGGAGATGACAATTCCACCTGG No data
1041389338_1041389343 -3 Left 1041389338 8:57335147-57335169 CCCGAAGCCCTCTTCTGTAAATG No data
Right 1041389343 8:57335167-57335189 ATGGAGATGACAATTCCACCTGG No data
1041389339_1041389343 -4 Left 1041389339 8:57335148-57335170 CCGAAGCCCTCTTCTGTAAATGG No data
Right 1041389343 8:57335167-57335189 ATGGAGATGACAATTCCACCTGG No data
1041389337_1041389343 -2 Left 1041389337 8:57335146-57335168 CCCCGAAGCCCTCTTCTGTAAAT No data
Right 1041389343 8:57335167-57335189 ATGGAGATGACAATTCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041389343 Original CRISPR ATGGAGATGACAATTCCACC TGG Intergenic
No off target data available for this crispr