ID: 1041390574

View in Genome Browser
Species Human (GRCh38)
Location 8:57343883-57343905
Sequence CAAGCTACTTAAACTCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 5, 3: 48, 4: 315}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041390566_1041390574 21 Left 1041390566 8:57343839-57343861 CCTGGGGTTCTGGCTCTGTCCCG 0: 1
1: 0
2: 0
3: 16
4: 227
Right 1041390574 8:57343883-57343905 CAAGCTACTTAAACTCTCAGAGG 0: 1
1: 0
2: 5
3: 48
4: 315
1041390568_1041390574 2 Left 1041390568 8:57343858-57343880 CCCGTATCAGCTAGGAAACCCAG 0: 1
1: 0
2: 1
3: 5
4: 78
Right 1041390574 8:57343883-57343905 CAAGCTACTTAAACTCTCAGAGG 0: 1
1: 0
2: 5
3: 48
4: 315
1041390569_1041390574 1 Left 1041390569 8:57343859-57343881 CCGTATCAGCTAGGAAACCCAGG 0: 1
1: 0
2: 1
3: 3
4: 125
Right 1041390574 8:57343883-57343905 CAAGCTACTTAAACTCTCAGAGG 0: 1
1: 0
2: 5
3: 48
4: 315
1041390565_1041390574 25 Left 1041390565 8:57343835-57343857 CCGGCCTGGGGTTCTGGCTCTGT 0: 1
1: 1
2: 3
3: 42
4: 344
Right 1041390574 8:57343883-57343905 CAAGCTACTTAAACTCTCAGAGG 0: 1
1: 0
2: 5
3: 48
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041390574 Original CRISPR CAAGCTACTTAAACTCTCAG AGG Intergenic
902044751 1:13515768-13515790 CAAGCCACTTGATCTCTCTGGGG + Intergenic
902187836 1:14738812-14738834 CAAGTTGCTTAACCTCTCTGAGG - Intronic
903233645 1:21936530-21936552 CACGCTAGTTAACCTCTCTGAGG - Intronic
904390288 1:30180607-30180629 CAAACTACTTTTACTCTAAGGGG + Intergenic
904499084 1:30903753-30903775 CAAGCTGCTTTACCTCTCTGGGG - Intronic
904847941 1:33434856-33434878 CATGTTACTTAATCTCCCAGAGG - Intergenic
904974888 1:34448385-34448407 CAAGCTAATGAACCTCTCTGGGG - Intergenic
905298161 1:36967759-36967781 CAGGTTACTTAAACTCTCTAAGG + Intronic
905663055 1:39743176-39743198 CCAGCTGCTTAAACTCTCTTAGG - Intronic
905805855 1:40877186-40877208 CAAGTTACTTCACCTCTCTGTGG - Intergenic
906036428 1:42753011-42753033 CAAGTTACTTAACCTCCCTGAGG + Intronic
906494862 1:46297817-46297839 CAAGTTACTTAATTTCTCTGTGG + Intronic
906789384 1:48645324-48645346 CAAGTTACTTAGCCTCTCTGTGG + Intronic
906852850 1:49270416-49270438 CAAGCATGTTAAGCTCTCAGGGG + Intronic
907920705 1:58908957-58908979 CAGGTTACTTAACCTCTCTGAGG + Intergenic
910712697 1:90198064-90198086 CCAGCTACTTAAAATGTCAAAGG + Intergenic
911415773 1:97571391-97571413 CAAGTCACTTAAACTTTCTGAGG - Intronic
911441756 1:97935561-97935583 CAAGGAACTTAAACTCCTAGAGG - Intergenic
912153358 1:106885195-106885217 CAATCTCCTTTAACTCTCAAAGG - Intergenic
912280786 1:108310666-108310688 CAAGTTACTTTAACTCTTAAAGG - Intergenic
914204256 1:145513570-145513592 CAAGGTGTTTAAAGTCTCAGAGG + Intergenic
914483380 1:148086757-148086779 CAAGGTGTTTAAAGTCTCAGAGG + Intergenic
915076386 1:153311389-153311411 CAAGTGACTCAAACTCTCTGAGG - Intergenic
916930606 1:169574710-169574732 CAAGATATTTAAACTCTCTGAGG - Intronic
917739082 1:177945933-177945955 CAAGCTACTTAGAGTCCCACTGG - Intronic
918285587 1:183051550-183051572 CAAGCTACTCCAAAGCTCAGTGG - Intronic
918851001 1:189690229-189690251 CAAGCCACTTAACCTCTCTAAGG + Intergenic
920812253 1:209297353-209297375 TTTGCTACTTTAACTCTCAGAGG + Intergenic
921631194 1:217436383-217436405 TAAGTTACTTCAACTCTCTGAGG - Intronic
921944006 1:220874029-220874051 CAAGCCACTTAACCTTTCTGAGG + Intergenic
923882407 1:238117948-238117970 CAAGTTACTTAACCTCTCTGTGG - Intergenic
924791948 1:247259429-247259451 CTTGATACTTAAACTCTGAGGGG - Intergenic
924888376 1:248245308-248245330 CATGCCACTTAAAGTCTCATGGG + Intergenic
1063320375 10:5046426-5046448 CAAGCTAATTGAACTCTTTGAGG - Intronic
1064140908 10:12789460-12789482 CAAGTTACTTAACTTCTCTGAGG + Intronic
1067420984 10:46147508-46147530 CAAGTTACTTAGACTCTCTAAGG - Intergenic
1067490809 10:46700129-46700151 CAAGTTACTTAGACTCTCTAAGG - Intergenic
1067506322 10:46853974-46853996 CAAGTTACTTAGACTCTCTAAGG - Intergenic
1067603854 10:47640238-47640260 CAAGTTACTTAGACTCTCTAAGG + Intergenic
1068148533 10:53101550-53101572 CAAGTTACATAAACACTCAGAGG - Intergenic
1068802136 10:61153315-61153337 CAAGTTACTTAAACTCTCCAAGG + Intergenic
1070386098 10:75926007-75926029 CAAGTTACTTAACCTCTCTGGGG - Intronic
1070975477 10:80602975-80602997 CTAGTTACTTAACCTCTCAGAGG + Intronic
1071540159 10:86475091-86475113 CAATTTACTTAAACTTCCAGGGG + Intronic
1072448956 10:95523748-95523770 TAAGCTACTTAACCTTTTAGAGG - Intronic
1073429505 10:103477005-103477027 CCAGCTTCTTAAATCCTCAGTGG + Intronic
1073443608 10:103567792-103567814 CAAGCCACTTAATCTCCCTGAGG + Intronic
1073456489 10:103639924-103639946 CAAGACACTTACATTCTCAGAGG + Intronic
1076069938 10:127481161-127481183 CAAGCTACCTAAATTATCAGAGG - Intergenic
1076307149 10:129473481-129473503 CAAGTCACTCAAACTCTCCGAGG - Intronic
1077806082 11:5592408-5592430 CAAGTTACTTAACCTCTCTTGGG - Intronic
1078067394 11:8087369-8087391 CAAGCCACTCACACTTTCAGAGG - Intronic
1078389541 11:10924940-10924962 CAAGCTCCTTTACCTCTCTGGGG + Intergenic
1078468448 11:11568233-11568255 CAAACAACCTCAACTCTCAGTGG - Intronic
1079025199 11:16941696-16941718 CAAGCTACATAAACTCACTGAGG - Intronic
1079547611 11:21652939-21652961 CAAGATATTTAAATTCTCTGTGG - Intergenic
1080038857 11:27738007-27738029 CAGGCTACCTGAATTCTCAGGGG + Intergenic
1081102303 11:39019764-39019786 CAAGTTACTTAACCTGTAAGTGG + Intergenic
1081677626 11:44980221-44980243 CTAGCCACTTAACCTCTCTGTGG - Intergenic
1081707555 11:45193391-45193413 CAAGCTACCTAAAAACCCAGTGG + Intronic
1081812468 11:45921817-45921839 CAGGTCACTTAAACTCTCCGGGG + Intronic
1084965523 11:72742420-72742442 CCAGTTACTTAACCTCTCTGAGG - Intronic
1085717400 11:78884853-78884875 CAAGCTACTTAAGCTCATGGGGG + Intronic
1087023047 11:93622358-93622380 CAGGCTTCTTAAACTCTTAAGGG - Intergenic
1087078013 11:94143575-94143597 CAACTTACTTAACCTCTCTGAGG - Intronic
1087123453 11:94599034-94599056 CAAGTTACAAAAACTCTCATTGG + Intronic
1087593012 11:100216159-100216181 GAAGCTACTCATACTCTCCGTGG + Intronic
1088062010 11:105665356-105665378 CAAGTAACTTAAACTTTCAGGGG - Intronic
1088591508 11:111407797-111407819 CAAGTTACTTACCCTCTCTGAGG - Intronic
1088969017 11:114754982-114755004 CAACTTACTTAAACTAACAGTGG - Intergenic
1089127484 11:116186915-116186937 CAAGCTACTTAATCTCTCTAAGG + Intergenic
1089251945 11:117170509-117170531 GAGGCTACTTGAACTGTCAGGGG + Exonic
1090494175 11:127193628-127193650 CCAGTTACATAAACTCTCTGAGG - Intergenic
1090596207 11:128323649-128323671 CAAGCTCCTTAACCTCTGAGAGG + Intergenic
1092013469 12:5136820-5136842 CCAGCTACTTAGCCTCTCTGAGG + Intergenic
1092906177 12:13101893-13101915 CAAGTTACTTAACCTCCCAGAGG + Intronic
1093625038 12:21335956-21335978 CAAGGAACTTAAACTTTCATTGG + Intronic
1094173191 12:27516040-27516062 CAAGTTACTTAAGCTCTCTGTGG + Intergenic
1095248608 12:39952131-39952153 CAACCTACTTAAGGACTCAGTGG - Intronic
1098008971 12:66030272-66030294 CAAGCTTCTCAAACTATCTGTGG - Intergenic
1100442908 12:94633700-94633722 CAAGCTTATTAACTTCTCAGTGG - Intronic
1100482450 12:94992348-94992370 CAAGTTCCTTAACCTCTCTGGGG - Intronic
1100897068 12:99194990-99195012 CATGCTAATAAAACTATCAGAGG + Intronic
1101493492 12:105232175-105232197 CAAGTTACTCAATCTCTCTGAGG - Intronic
1101722183 12:107359767-107359789 CAAGTTACTTAAAGTCCCTGAGG - Intronic
1103187675 12:118974819-118974841 TAAGTTACTTAAACTCTCTGTGG + Intergenic
1103218725 12:119225220-119225242 CAAGTTACTTAACCTCTCTGAGG + Intergenic
1103866996 12:124060698-124060720 CAAGTTTCTAAAACTCTAAGAGG - Intronic
1106107868 13:26749924-26749946 CAAGTTACTTAACTTCTCTGAGG - Intergenic
1106488651 13:30195278-30195300 CAAGTTACTTATCCTCTCTGTGG - Intergenic
1106920692 13:34560194-34560216 TAACCTACACAAACTCTCAGAGG - Intergenic
1107385730 13:39906866-39906888 CAAGTTACTTAACCTCTCAGAGG - Intergenic
1107533206 13:41304189-41304211 CAAGGTCCTTAATCTCTCATTGG - Intergenic
1107552735 13:41492498-41492520 CAAGCTCTTTAACCTCTCAGAGG + Intergenic
1108258759 13:48636318-48636340 CAAGTTGCTGAATCTCTCAGTGG + Intergenic
1108485623 13:50921191-50921213 CAAGATACTCAACCTCTCTGTGG - Intronic
1110161899 13:72388487-72388509 TAAGTTACTTAAATTCTCTGAGG + Intergenic
1110565741 13:76956161-76956183 AAAGCTCCTAAAACTCTAAGAGG + Intronic
1110937065 13:81304690-81304712 CAAACTGCGTGAACTCTCAGAGG - Intergenic
1111356631 13:87114741-87114763 CAAGTTACTTAAATTATCATAGG - Intergenic
1112040838 13:95546337-95546359 CAAGTGACTTAATCTCTCTGTGG + Intronic
1112154932 13:96807033-96807055 CAAGTGACTTAAATTCTCTGTGG + Intronic
1112243951 13:97711190-97711212 CAAGCCACTCAAAATCTCAGTGG - Intergenic
1114352200 14:21865067-21865089 CAAGTTACTAAAAATTTCAGAGG + Intergenic
1115444578 14:33474963-33474985 TAAACTACTTAATCTCTCTGAGG - Intronic
1115622502 14:35153472-35153494 CAAGTCACTTAACCTCTCTGAGG - Intronic
1115745379 14:36431365-36431387 CAAGCTATTGAAACTTTCAAAGG + Intergenic
1116801772 14:49451282-49451304 GGATCCACTTAAACTCTCAGAGG + Intergenic
1117734822 14:58757841-58757863 CAAGTTAGTTAACCTCTCTGAGG - Intergenic
1117911749 14:60643303-60643325 GAAGCTTCCTAAATTCTCAGAGG - Intergenic
1118323991 14:64769272-64769294 CAAGTTATTTAACCTCTCTGAGG + Intronic
1118587934 14:67373657-67373679 CAAGTTACTTAACCTTTCATGGG + Intronic
1118870833 14:69739945-69739967 CAAGCTGCTTAAAGTCTCCTTGG - Intronic
1118918322 14:70127142-70127164 CAAGCAAATTAAACTATAAGGGG + Intronic
1119001407 14:70885253-70885275 CAAGCCACTTAACCTCTCTGAGG + Intergenic
1119195582 14:72714773-72714795 CAAGCTACTTAACCTCTCTATGG - Intronic
1119515318 14:75243497-75243519 CATGTTACTTAATCTCTCTGTGG - Intronic
1120237402 14:81908306-81908328 CAAGCTAGTTAAACATTCTGGGG + Intergenic
1121224950 14:92314869-92314891 CAAGTTACTTAAAGATTCAGAGG + Intergenic
1121525163 14:94614402-94614424 AAAGCTCCTTTAAGTCTCAGAGG - Exonic
1124614994 15:31235101-31235123 CAAGGGACTTAGGCTCTCAGTGG + Intergenic
1125283667 15:38070201-38070223 CAAGCCACTTTACCTCTCTGAGG + Intergenic
1126543914 15:49852113-49852135 AAAGTTACTTAACCTCTCTGGGG + Intergenic
1127638893 15:60896842-60896864 CAAGTCACTTAACCTCTAAGAGG + Intronic
1127658691 15:61079898-61079920 CAAGTTACTTAAGCTCTTAAGGG + Intronic
1128182877 15:65620478-65620500 CAAGTTATTTAACTTCTCAGTGG - Intronic
1128729489 15:70011110-70011132 CAAGCCATCCAAACTCTCAGAGG + Intergenic
1131750071 15:95496490-95496512 CCATCCACTGAAACTCTCAGTGG + Intergenic
1131841305 15:96440835-96440857 CAAGCTCCTTGACCTCTGAGGGG - Intergenic
1133553166 16:6878741-6878763 CAGGGTCCTTAAACTCTCATGGG - Intronic
1134081743 16:11329450-11329472 TAAGTTACTTAACCTCTCAAAGG + Intronic
1134791060 16:16989722-16989744 CAAGCTACATAAAATCTCAGTGG + Intergenic
1134820887 16:17246569-17246591 CAAGCTACTTAACCTCTCTGAGG + Intronic
1136013519 16:27380522-27380544 CAAGTTACTTAAATTCCCTGTGG + Intergenic
1137720072 16:50622598-50622620 CAAGTTCCCTAAAGTCTCAGTGG + Intronic
1138017745 16:53445550-53445572 CAAATTACTTAACCTCTCTGCGG - Intronic
1138201648 16:55093007-55093029 CAAGTTACTTAATATCTCAATGG - Intergenic
1138387477 16:56645720-56645742 CAAGGTGCTTAATCTCTCTGAGG + Intronic
1139369961 16:66460859-66460881 AAAGTTACTTAACCTCTCTGAGG + Intronic
1140087472 16:71809563-71809585 CAAGTCACTTAAACTCTCCAGGG + Intergenic
1142772826 17:2111842-2111864 CAAGCTGCATAAACTCTCAAAGG - Intronic
1143075624 17:4340348-4340370 AAATCTACTCAAACTCTCACTGG - Intronic
1143401512 17:6647787-6647809 CAAGGTACTTAACCTCTCTAAGG + Intronic
1144261263 17:13523726-13523748 CAAGTTGCTAAAACTCTCTGTGG - Intronic
1145738012 17:27247223-27247245 CAAGTTGCTTAACCTCTCTGAGG + Intergenic
1146422192 17:32698057-32698079 CAAGGTCCTTAACCACTCAGTGG + Intronic
1146954359 17:36928532-36928554 CCAGATAATTAAACACTCAGCGG + Intergenic
1147673298 17:42189234-42189256 TATTCTACATAAACTCTCAGAGG - Exonic
1153380241 18:4430399-4430421 CATGTTACTTAATCTCTCTGGGG + Intronic
1154329363 18:13416982-13417004 CAAGCCACTTAACCTGTCTGTGG - Intronic
1155338230 18:24786758-24786780 CAAGCTACTTATCCTTTCTGAGG + Intergenic
1157141193 18:45108690-45108712 CAATCAACTTGGACTCTCAGTGG - Intergenic
1158721246 18:59926895-59926917 CAATTTACTTAACCTCTCTGTGG + Intergenic
1164649582 19:29882357-29882379 GAAGCTCCTTAACCTCTCACAGG + Intergenic
1167222008 19:48205672-48205694 CAAGTTATTTAACCTCTCTGTGG - Intronic
925674773 2:6350502-6350524 CAAGTTGCTTAACCTCTCTGAGG + Intergenic
926577273 2:14595989-14596011 CAAGCCACTTAACTTCTCTGTGG + Intergenic
926934648 2:18074814-18074836 CAAGTTACTCAAATTCTCTGAGG + Intronic
928692193 2:33811663-33811685 TAAGGACCTTAAACTCTCAGAGG + Intergenic
930431576 2:51283413-51283435 CAAGCTTTTCATACTCTCAGAGG + Intergenic
932063946 2:68533449-68533471 CAAGCTACTCCAACTCTTAGTGG + Intronic
932281482 2:70496598-70496620 CAAGTCACTGAAACTCTCTGGGG + Intronic
932334882 2:70924655-70924677 CAAGTTAGTTAACCTCTCTGAGG - Intronic
932694674 2:73945475-73945497 TAAGTTACTTAACCTCTGAGTGG + Intronic
932743484 2:74311020-74311042 CAAACTACTAAAACTCACACAGG - Intronic
932845450 2:75130399-75130421 CATGTTACTTAAACTGTTAGGGG - Intronic
933154439 2:78957490-78957512 GAAGTTACTTTACCTCTCAGAGG + Intergenic
936102656 2:109596772-109596794 AAGCCTACTTAAAATCTCAGTGG + Intronic
936918754 2:117666004-117666026 CAAGTTACTTAAACTCACTTGGG - Intergenic
937458813 2:122067876-122067898 CAAGTTGCTTAACCTCTCTGTGG + Intergenic
938670882 2:133585453-133585475 CAAACTACTTAAGCTATCAGAGG - Intergenic
938923812 2:136020268-136020290 CAAGTTACTTAACCTTTCTGTGG + Intergenic
939169958 2:138684170-138684192 CAAGCCACTTAACCTCTCTAAGG - Intronic
939207740 2:139129171-139129193 CAAAATACAAAAACTCTCAGAGG - Intergenic
941835436 2:170012690-170012712 CAAGTTACTCAATTTCTCAGGGG - Intronic
942022510 2:171880939-171880961 CAAGCTACTTAACCTTTCTGGGG + Intronic
942670412 2:178369505-178369527 CAAGTTACTTAACCTTTCTGGGG - Intronic
942896108 2:181056425-181056447 CAGGCTGCTTCAACTCACAGTGG + Intronic
942963119 2:181856393-181856415 CAAGCAAATTCAACTCTGAGGGG + Intergenic
944689486 2:202146858-202146880 CAGGCTATTTAACCTCTCTGAGG + Intronic
945884846 2:215364109-215364131 CAAGCTAATTAAGTTCTAAGTGG - Intronic
946349934 2:219143552-219143574 CAAGTCACTTAACCTCTCTGAGG + Intronic
946368754 2:219267261-219267283 CAAGCTACTTGACTTCTCTGAGG + Intronic
946881943 2:224185328-224185350 CAGGCTGCTTCAACTCACAGTGG + Intergenic
946940069 2:224761103-224761125 CCAGCTACTTGGACTCCCAGTGG - Intergenic
948268758 2:236657737-236657759 CAAGCTTCTTCCACTCTCTGTGG + Intergenic
1169269918 20:4191303-4191325 CAAGTTACTTAACTTCTCTGAGG - Intergenic
1169669064 20:8075099-8075121 CAAACTACGTCAAATCTCAGTGG + Intergenic
1170712547 20:18805474-18805496 CAAACCACTTAAAAGCTCAGAGG + Intergenic
1170743698 20:19079943-19079965 CAAGGGACTTAGACCCTCAGAGG - Intergenic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1171016973 20:21550736-21550758 CAATTTACTTAATCTCTCCGAGG + Intergenic
1171329450 20:24324764-24324786 AAAGTTACTGAAAATCTCAGGGG + Intergenic
1172086220 20:32385231-32385253 CAATTTACTTAAACTCTCACAGG - Intronic
1172543822 20:35743342-35743364 CAAGCAAATTAACCTCTCAGAGG + Intergenic
1173323140 20:42007670-42007692 CAAGTTACTTAACCTCTCCGAGG + Intergenic
1173331904 20:42082278-42082300 CAAGCTAATTGAACTCTCAAAGG - Intronic
1173434966 20:43024153-43024175 CAAGCTACTCAACCTCTCTGAGG + Intronic
1173775836 20:45705473-45705495 CAAGCTAATTAACCTCTCTCTGG + Intronic
1174621760 20:51880357-51880379 CAAGTCACTTAACCTCTCTGAGG - Intergenic
1175055011 20:56190216-56190238 GAAGTTGCTTAAACTCTCTGAGG - Intergenic
1175683858 20:61012060-61012082 CAAGCTACTGAAGGTCTGAGTGG + Intergenic
1176667592 21:9701748-9701770 CAAGCAACCCAAAATCTCAGTGG - Intergenic
1177420461 21:20850038-20850060 CAAGTTACTTAAGACCTCAGAGG - Intergenic
1178704903 21:34865008-34865030 CAAGTTACTTGACCTCTCTGGGG + Intronic
1181171013 22:21010111-21010133 CAAGCTCCTTCACCTCTCAAGGG + Intronic
1182574034 22:31260909-31260931 CTTGCTGCTTAAACTCTCAATGG - Intronic
1182824518 22:33253384-33253406 CAACATACTTACAGTCTCAGAGG - Intronic
1183492783 22:38125655-38125677 CAAGTCACTTCACCTCTCAGGGG + Intronic
1183990017 22:41591520-41591542 CAAGTCACTTCACCTCTCAGAGG + Intergenic
1184816672 22:46877157-46877179 CAAGTCACTTAACCTCTCTGAGG + Intronic
1185200074 22:49496477-49496499 CAAGTTACTTCACCTCTGAGTGG - Intronic
950180786 3:10911768-10911790 CAAGTTACTTAACCTCTCTGAGG - Intronic
950684209 3:14604921-14604943 CAAGATATTTAAACTGTCTGAGG - Intergenic
951503039 3:23411710-23411732 CAAGCTACCTAAATTCTCATTGG + Intronic
951542310 3:23793591-23793613 CAAGTTGCTTGAACTCTCTGTGG + Intergenic
951608233 3:24461262-24461284 CAAGTTACTTAACTTCTCTGAGG + Intronic
951977168 3:28525037-28525059 CAAGCTATTATAATTCTCAGAGG + Exonic
955071296 3:55574658-55574680 CAAACTTCTTAAATCCTCAGTGG - Intronic
955567155 3:60259674-60259696 CAAGTTAATTAACCTCTCTGAGG - Intronic
955591231 3:60538075-60538097 GAAGCTACCTAGACTCTTAGAGG - Intronic
956261786 3:67351148-67351170 CAAACAACTGAAAATCTCAGGGG - Intergenic
957153511 3:76517693-76517715 CAAGTTACTTAAACTTTAAATGG - Intronic
957432435 3:80128777-80128799 CAAATTACTTTACCTCTCAGAGG + Intergenic
958163919 3:89854529-89854551 CAAGTTATTTAATCTCTCAGTGG - Intergenic
958433173 3:94065918-94065940 CAAATTACTTAAACTCTTAACGG - Intronic
958967931 3:100579711-100579733 CAAGCTGCTTCCACTCACAGCGG - Intergenic
960347897 3:116557224-116557246 AAAGCTACTTCAAGCCTCAGAGG - Intronic
960413523 3:117357094-117357116 CACATTACTTAACCTCTCAGAGG - Intergenic
960844081 3:121990858-121990880 CATGCTACTCAACCTCTCAGAGG + Intronic
960953064 3:123012119-123012141 CAAGTTTCTTAACCTCTCTGAGG + Intronic
962176049 3:133156532-133156554 CAAGTCACTTAATCTCTCTGAGG + Intronic
962297863 3:134209252-134209274 CAAGTTACTTAACCTCTCTGAGG - Intronic
962650099 3:137479876-137479898 CAAGCTCATTAAACTCTTACAGG + Intergenic
962848966 3:139293746-139293768 CAAGTCACTTAACCTCTCTGAGG + Intronic
963133909 3:141883005-141883027 CAAACTCTTTAAAATCTCAGTGG + Intronic
964388404 3:156173568-156173590 CAAGCCCCTTAACCTCTCTGGGG + Intronic
964499058 3:157328033-157328055 CAAGTTACATAACCTCTCTGTGG + Intronic
964556459 3:157944899-157944921 CAAGTTACTTAAGGTCTCTGAGG + Intergenic
965214275 3:165841034-165841056 CAAGTTACTTAAACTCTTTGTGG - Intergenic
966273443 3:178136484-178136506 CAAGTGACTCAAACTCTCTGAGG - Intergenic
966704021 3:182890817-182890839 CAAGTTTCTTAACCTCTCTGAGG - Intronic
967488601 3:190062698-190062720 CAAGTTACTCAATCTCTCTGTGG + Intronic
969256591 4:6006688-6006710 CAAGCTTCTTAAACTCTGGAGGG - Intergenic
969848551 4:9938735-9938757 CAAGCTACTCAGCCTCTGAGTGG + Intronic
970129612 4:12852992-12853014 CAGGTGACTTAAACTCTCTGTGG - Intergenic
971647103 4:29220875-29220897 CCAGCTTATGAAACTCTCAGAGG - Intergenic
971704844 4:30027878-30027900 CAAGTTACTTCAACTCTCTGAGG - Intergenic
971905030 4:32715396-32715418 CAACCTCCTTAGACTCTCTGTGG - Intergenic
972611388 4:40658821-40658843 CAAGTTATTTAACCTCTCTGTGG + Intergenic
972831454 4:42818819-42818841 CAAGTTATTTAAATTTTCAGGGG + Intergenic
974022099 4:56700847-56700869 TAAGCTGCTTACACTGTCAGAGG + Intergenic
975102258 4:70527086-70527108 CAAGTTACTTAACCACTCTGTGG + Intronic
977714071 4:100161256-100161278 AAAGTAACTTAATCTCTCAGCGG - Intergenic
977725843 4:100296138-100296160 CAAGCTACTTCAAAACTTAGTGG + Intergenic
977920600 4:102638454-102638476 CAAGACACTCAAACTCTAAGTGG - Intronic
978964825 4:114727697-114727719 TAAGCTCCTTAAAGTCTCTGTGG + Intergenic
979375903 4:119946434-119946456 CAAGCTACAAGAACACTCAGAGG + Intergenic
981715140 4:147745121-147745143 CAAGCTACTTGACCTCTCTGTGG - Intronic
982033589 4:151325112-151325134 CCGGCTTCTTTAACTCTCAGAGG - Intronic
983395069 4:167183273-167183295 TAAGCTACCTAAAAACTCAGTGG - Intronic
984655200 4:182310017-182310039 CAGGTTACTTAAGCTCTCTGAGG - Intronic
984675356 4:182541072-182541094 CAAGTTTTTTAAACTCTTAGCGG - Intronic
984896596 4:184547030-184547052 CAAGCTACATAGACTGTAAGTGG - Intergenic
985407213 4:189649857-189649879 CAAGCAACCCAAAATCTCAGTGG + Intergenic
986747282 5:10755638-10755660 CAAACAACCTAAATTCTCAGTGG - Intronic
987276940 5:16372732-16372754 CAAGCTACTTAATTTCTCTGTGG - Intergenic
987688551 5:21237287-21237309 CCAGCTAAATAAACTCTCCGTGG - Intergenic
989151973 5:38308532-38308554 CAAGTTACTTAAACTTTCTTGGG + Intronic
990445400 5:55889371-55889393 CAAGCTGCTGAAAGTCTCAATGG - Intronic
990722924 5:58718324-58718346 AATGCTATTTAAACACTCAGAGG - Intronic
990756463 5:59077097-59077119 CAAGTTACTTAACCTCTCTCTGG + Intronic
991636897 5:68715425-68715447 CAAGCTACTGAAAATCTTAAGGG - Intergenic
992914508 5:81434076-81434098 CACGTTACTTAATCTCTCATAGG - Intronic
993076850 5:83242877-83242899 CAAACTACTTAATCTCACTGTGG - Intronic
993809801 5:92462229-92462251 CAAGTTATTTAAACTCTTAATGG + Intergenic
994777950 5:104059310-104059332 CAATGGACTTAAACTGTCAGAGG - Intergenic
996471574 5:123867310-123867332 CTAGCTTCTTAACCTCACAGAGG - Intergenic
997450646 5:133980187-133980209 CAATCTACTTCAATTCTCAAGGG + Intronic
997575675 5:134975067-134975089 CAAATTACTTAAGCTCTCTGTGG + Intronic
997605145 5:135169956-135169978 CAAGTTACTTCACCTCTCTGAGG - Intronic
998561238 5:143173640-143173662 CAAGTTACTTAACCTTTCTGAGG - Intronic
999496143 5:152100241-152100263 CAAGCTACTTAACTCCTCTGAGG + Intergenic
999626859 5:153530190-153530212 CAAGCTATTTAACCTTTCTGTGG - Intronic
999896308 5:156037596-156037618 CAAGCTACCTAATCTATGAGTGG - Intronic
1000110444 5:158103189-158103211 CAAGCTATTTAAACTCTCTGTGG - Intergenic
1000955109 5:167533952-167533974 CAAGCTATTGAACCTCTCAGAGG + Intronic
1003728143 6:8790044-8790066 CAAGTTACTTAACCTCTCTGTGG - Intergenic
1003853000 6:10243981-10244003 CAATCTACGTAAACACTAAGAGG + Intergenic
1005130309 6:22499256-22499278 CAATCTAGTTAAACTATCATTGG - Intergenic
1006728899 6:36220423-36220445 CAAGTTACTTAACTTCTCCGAGG - Intronic
1006732116 6:36244003-36244025 CAAGCTACTCAACCTCTCTGGGG - Intronic
1007011641 6:38423947-38423969 CAAGTTACTTGACCTTTCAGAGG + Intronic
1008052222 6:46912099-46912121 CAAGTTATTTAACCACTCAGTGG - Intronic
1013511273 6:110846454-110846476 CAAGTTACAGAAACTATCAGAGG + Intronic
1014757048 6:125312919-125312941 CAAGTCACTTAAACTCTCCTGGG - Intergenic
1015754772 6:136596314-136596336 CAACCTACTCAACTTCTCAGTGG - Intronic
1015886540 6:137923863-137923885 CAAGCCACTTAACCACTCAATGG + Intergenic
1017893124 6:158655784-158655806 CAAGTTACTTAAGCCCTCTGGGG - Intronic
1018256406 6:161924057-161924079 GAAGTTACTTAACCTCTCTGGGG + Intronic
1019689541 7:2403102-2403124 CAAGTGACTTAACCTCTCTGAGG - Intergenic
1020601591 7:10281120-10281142 CAACCTATTCAAACCCTCAGTGG + Intergenic
1021773323 7:24026736-24026758 TAAGCAATTTAAACTCCCAGTGG - Intergenic
1022625403 7:32031365-32031387 CAAGTTACTTAATCTTTCTGGGG - Intronic
1023204612 7:37734310-37734332 CAAACTACTTAACCTCTCTGAGG - Intronic
1024874414 7:54005425-54005447 CAAGCAACTCAAAATCTCAGTGG - Intergenic
1026032692 7:66808120-66808142 AAAGTTACTTAAGCTCTCTGAGG - Intronic
1028971270 7:96860988-96861010 CAAGCAACCTGAAATCTCAGTGG + Intergenic
1029991300 7:104965051-104965073 CAAGTTACTTAACCTCTCTAGGG + Intergenic
1032500517 7:132396414-132396436 CATGCTACTTAACCTCTCTGTGG - Intronic
1034577247 7:152011060-152011082 CAAGTTACTCAACCTCTCTGTGG - Intronic
1034739485 7:153460566-153460588 CAAGTCACTTAATCTCTCTGAGG - Intergenic
1035634417 8:1133177-1133199 CAAGCTACTTAAGCACTCCTGGG + Intergenic
1036539821 8:9695364-9695386 GAAGTTACTTTAATTCTCAGTGG + Intronic
1036767961 8:11560829-11560851 CAAGCTGCTTAACCTCCCCGAGG - Intronic
1037949311 8:23008409-23008431 CAAGTCACTTAACTTCTCAGGGG - Intronic
1038480116 8:27896083-27896105 TAAGCTCCTGAACCTCTCAGAGG + Intronic
1039482828 8:37887656-37887678 CAAGATATTTAACCTCTCTGTGG + Intronic
1039802471 8:40971308-40971330 AAAGCTGCTTAAACTTTCATAGG + Intergenic
1041390574 8:57343883-57343905 CAAGCTACTTAAACTCTCAGAGG + Intergenic
1041574298 8:59375961-59375983 CAAGTTACCTAAACACTCTGAGG + Intergenic
1042120905 8:65487094-65487116 CTAGTTACTTAACCTCTCTGTGG + Intergenic
1042915867 8:73875559-73875581 GAAGTTACTTAAGCTCTAAGAGG - Intronic
1043293132 8:78628809-78628831 CAAGCAACTTAAACTCTGTTTGG - Intergenic
1043296658 8:78672012-78672034 CAAGATACTTAAGCTCTCTAAGG - Intronic
1044602631 8:94020929-94020951 CAAGCTACTCATGCTTTCAGAGG - Intergenic
1045351660 8:101346335-101346357 CAATTTACTTAACTTCTCAGTGG + Intergenic
1047434595 8:124825685-124825707 CAAGTTACCTACCCTCTCAGGGG - Intergenic
1047693245 8:127377842-127377864 TAAGTTACTTAACCTCTCTGTGG + Intergenic
1048514293 8:135091840-135091862 CAAGCTACTTCCCCTCTCAAAGG - Intergenic
1050297905 9:4225123-4225145 CAAGCTCCTTAACGTCTCTGAGG - Intronic
1050422484 9:5481030-5481052 CAAGTTACCTAAACTTTCTGTGG - Intergenic
1051506534 9:17832912-17832934 CAAGCTACTTAAGGTCTATGGGG + Intergenic
1051857642 9:21587363-21587385 CAAGTTAGTTAGACTCTCTGAGG - Intergenic
1052135283 9:24901738-24901760 GAAGCTACCTAAACTCAGAGAGG + Intergenic
1052245839 9:26333554-26333576 CCAGCTACTTAATCTTTCAAAGG + Intergenic
1053441296 9:38118459-38118481 CAAGCTACTCAACTTCTCTGAGG + Intergenic
1057974887 9:99594683-99594705 CAAGTTACTTAAACTCTTTGAGG + Intergenic
1059217971 9:112584208-112584230 CAAGTTACTTAACCTTTCTGTGG + Intronic
1059851712 9:118348557-118348579 CAAGTTACTTAATATCTCTGTGG - Intergenic
1061282659 9:129606414-129606436 CAAGTTACTTAACCTCTCTGTGG + Intergenic
1203658223 Un_KI270753v1:18951-18973 CAAGCAACCCAAAATCTCAGTGG + Intergenic
1186600892 X:11036032-11036054 CAAGTTACTTGACCTCTCTGTGG - Intergenic
1186915118 X:14210564-14210586 CAAGCTACTTAAGCTCTCTGTGG - Intergenic
1187567728 X:20468749-20468771 CAAGTTGCTTAAACACTCTGAGG - Intergenic
1187888332 X:23909801-23909823 CAAGTCACTTAACCTCTCAGTGG - Intronic
1188049784 X:25470611-25470633 CAAGCCACTTCAAAACTCAGTGG - Intergenic
1188333747 X:28902458-28902480 GAAGTTTCTTGAACTCTCAGGGG - Intronic
1189221098 X:39372736-39372758 AAACCTCCTTAAAATCTCAGTGG - Intergenic
1190433172 X:50397448-50397470 CAAGTTACTTAACCTCTCTGTGG - Intronic
1190690023 X:52906256-52906278 CAAGCTACGGAAACTCACACAGG - Intronic
1190691455 X:52916456-52916478 AAAGCTCCTTAAACTCTCTTTGG + Intergenic
1190694528 X:52939336-52939358 AAAGCTCCTTAAACTCTCTTTGG - Intronic
1190695960 X:52949536-52949558 CAAGCTACGGAAACTCACACAGG + Intronic
1191955727 X:66640463-66640485 CAAGTTACTTAACCACTCTGTGG + Intergenic
1192007145 X:67228371-67228393 CAAGTTACTTAATCTGTAAGTGG + Intergenic
1192549194 X:72040472-72040494 CAAGTAACTTAACCTCTCTGAGG - Intergenic
1193205556 X:78743724-78743746 CAATTTACTTAAACTTTCTGTGG + Intergenic
1194015731 X:88618183-88618205 CAAACTATTTAATCTCTCTGAGG - Intergenic
1195914329 X:109921110-109921132 AAAGTTACTTAACCTCTCTGAGG + Intergenic
1195935043 X:110117157-110117179 CAAGTTACTTAAACTTTCTAAGG - Intronic
1196363929 X:114901622-114901644 AAGGTTACTTAAACTCTGAGAGG - Intronic
1197329507 X:125136479-125136501 CACGTTACTTAACCTCTCTGAGG - Intergenic
1198032578 X:132767842-132767864 CAAGTTACTTAACCTCTCTGTGG - Intronic
1198095908 X:133379530-133379552 CAACCAACTTAAAGTATCAGTGG - Intronic
1198506951 X:137310481-137310503 CAAGTTACTTAACCTCTCCATGG + Intergenic
1200972630 Y:9171494-9171516 CATTCTTCTTTAACTCTCAGGGG + Intergenic
1202356443 Y:24055508-24055530 CACTCTCCTTTAACTCTCAGGGG + Intergenic
1202514335 Y:25614601-25614623 CACTCTCCTTTAACTCTCAGGGG - Intergenic