ID: 1041392157

View in Genome Browser
Species Human (GRCh38)
Location 8:57356548-57356570
Sequence GAAGCTTCCTAGACTCTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041392157_1041392158 -2 Left 1041392157 8:57356548-57356570 CCTTAGAGAGTCTAGGAAGCTTC No data
Right 1041392158 8:57356569-57356591 TCATCATTTGCTTATTTATTTGG No data
1041392157_1041392159 -1 Left 1041392157 8:57356548-57356570 CCTTAGAGAGTCTAGGAAGCTTC No data
Right 1041392159 8:57356570-57356592 CATCATTTGCTTATTTATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041392157 Original CRISPR GAAGCTTCCTAGACTCTCTA AGG (reversed) Intergenic
No off target data available for this crispr