ID: 1041399385

View in Genome Browser
Species Human (GRCh38)
Location 8:57425846-57425868
Sequence GGTTTCCAGAAGCAGAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041399385_1041399390 13 Left 1041399385 8:57425846-57425868 CCCACACTCTGCTTCTGGAAACC No data
Right 1041399390 8:57425882-57425904 GTTATCTCTGCGTTCCTCTCTGG No data
1041399385_1041399393 22 Left 1041399385 8:57425846-57425868 CCCACACTCTGCTTCTGGAAACC No data
Right 1041399393 8:57425891-57425913 GCGTTCCTCTCTGGGACTCTGGG No data
1041399385_1041399391 14 Left 1041399385 8:57425846-57425868 CCCACACTCTGCTTCTGGAAACC No data
Right 1041399391 8:57425883-57425905 TTATCTCTGCGTTCCTCTCTGGG No data
1041399385_1041399392 21 Left 1041399385 8:57425846-57425868 CCCACACTCTGCTTCTGGAAACC No data
Right 1041399392 8:57425890-57425912 TGCGTTCCTCTCTGGGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041399385 Original CRISPR GGTTTCCAGAAGCAGAGTGT GGG (reversed) Intergenic
No off target data available for this crispr