ID: 1041400856

View in Genome Browser
Species Human (GRCh38)
Location 8:57443210-57443232
Sequence TCCCTATGTTGCCAGAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041400854_1041400856 22 Left 1041400854 8:57443165-57443187 CCATCATGCATAGCTAAGTTTTT No data
Right 1041400856 8:57443210-57443232 TCCCTATGTTGCCAGAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041400856 Original CRISPR TCCCTATGTTGCCAGAGTGC TGG Intergenic
No off target data available for this crispr