ID: 1041401980

View in Genome Browser
Species Human (GRCh38)
Location 8:57455965-57455987
Sequence AACCTGGCTTTGCCTACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041401978_1041401980 7 Left 1041401978 8:57455935-57455957 CCTTACTCAGAATTTTCTAAGAT No data
Right 1041401980 8:57455965-57455987 AACCTGGCTTTGCCTACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041401980 Original CRISPR AACCTGGCTTTGCCTACTCC TGG Intergenic
No off target data available for this crispr