ID: 1041403275

View in Genome Browser
Species Human (GRCh38)
Location 8:57467191-57467213
Sequence CTGTAATTGTTGAATGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041403275_1041403276 15 Left 1041403275 8:57467191-57467213 CCATCTTCATTCAACAATTACAG No data
Right 1041403276 8:57467229-57467251 CTTTGCTTTTAAATATGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041403275 Original CRISPR CTGTAATTGTTGAATGAAGA TGG (reversed) Intergenic
No off target data available for this crispr