ID: 1041407237 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:57513475-57513497 |
| Sequence | CTGAGAATAAGGAGCTTCAT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1041407231_1041407237 | 10 | Left | 1041407231 | 8:57513442-57513464 | CCTATAATTCTGTAAATTTCTGG | No data | ||
| Right | 1041407237 | 8:57513475-57513497 | CTGAGAATAAGGAGCTTCATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1041407237 | Original CRISPR | CTGAGAATAAGGAGCTTCAT GGG | Intergenic | ||
| No off target data available for this crispr | |||||