ID: 1041407237

View in Genome Browser
Species Human (GRCh38)
Location 8:57513475-57513497
Sequence CTGAGAATAAGGAGCTTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041407231_1041407237 10 Left 1041407231 8:57513442-57513464 CCTATAATTCTGTAAATTTCTGG No data
Right 1041407237 8:57513475-57513497 CTGAGAATAAGGAGCTTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041407237 Original CRISPR CTGAGAATAAGGAGCTTCAT GGG Intergenic
No off target data available for this crispr