ID: 1041425316

View in Genome Browser
Species Human (GRCh38)
Location 8:57714151-57714173
Sequence CACCATTTATTGATGGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041425316_1041425322 -10 Left 1041425316 8:57714151-57714173 CCTTTCCCCATCAATAAATGGTG No data
Right 1041425322 8:57714164-57714186 ATAAATGGTGCTGGGAAAACTGG 0: 12995
1: 9164
2: 7523
3: 6813
4: 5740
1041425316_1041425324 18 Left 1041425316 8:57714151-57714173 CCTTTCCCCATCAATAAATGGTG No data
Right 1041425324 8:57714192-57714214 CACATGTAGAAAGCTGAAACTGG 0: 210
1: 11343
2: 4549
3: 4260
4: 4677

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041425316 Original CRISPR CACCATTTATTGATGGGGAA AGG (reversed) Intergenic
No off target data available for this crispr