ID: 1041425322

View in Genome Browser
Species Human (GRCh38)
Location 8:57714164-57714186
Sequence ATAAATGGTGCTGGGAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42235
Summary {0: 12995, 1: 9164, 2: 7523, 3: 6813, 4: 5740}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041425316_1041425322 -10 Left 1041425316 8:57714151-57714173 CCTTTCCCCATCAATAAATGGTG No data
Right 1041425322 8:57714164-57714186 ATAAATGGTGCTGGGAAAACTGG 0: 12995
1: 9164
2: 7523
3: 6813
4: 5740

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041425322 Original CRISPR ATAAATGGTGCTGGGAAAAC TGG Intergenic
Too many off-targets to display for this crispr