ID: 1041425324

View in Genome Browser
Species Human (GRCh38)
Location 8:57714192-57714214
Sequence CACATGTAGAAAGCTGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 25039
Summary {0: 210, 1: 11343, 2: 4549, 3: 4260, 4: 4677}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041425316_1041425324 18 Left 1041425316 8:57714151-57714173 CCTTTCCCCATCAATAAATGGTG No data
Right 1041425324 8:57714192-57714214 CACATGTAGAAAGCTGAAACTGG 0: 210
1: 11343
2: 4549
3: 4260
4: 4677
1041425320_1041425324 12 Left 1041425320 8:57714157-57714179 CCCATCAATAAATGGTGCTGGGA No data
Right 1041425324 8:57714192-57714214 CACATGTAGAAAGCTGAAACTGG 0: 210
1: 11343
2: 4549
3: 4260
4: 4677
1041425318_1041425324 13 Left 1041425318 8:57714156-57714178 CCCCATCAATAAATGGTGCTGGG 0: 2
1: 116
2: 1690
3: 16132
4: 9425
Right 1041425324 8:57714192-57714214 CACATGTAGAAAGCTGAAACTGG 0: 210
1: 11343
2: 4549
3: 4260
4: 4677
1041425321_1041425324 11 Left 1041425321 8:57714158-57714180 CCATCAATAAATGGTGCTGGGAA 0: 25
1: 66
2: 111
3: 128
4: 272
Right 1041425324 8:57714192-57714214 CACATGTAGAAAGCTGAAACTGG 0: 210
1: 11343
2: 4549
3: 4260
4: 4677

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041425324 Original CRISPR CACATGTAGAAAGCTGAAAC TGG Intergenic
Too many off-targets to display for this crispr