ID: 1041425817

View in Genome Browser
Species Human (GRCh38)
Location 8:57719123-57719145
Sequence CAAAATCAATGGAACCTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041425811_1041425817 15 Left 1041425811 8:57719085-57719107 CCTTAGAAAACTGGTAACCTAGA No data
Right 1041425817 8:57719123-57719145 CAAAATCAATGGAACCTGATTGG No data
1041425808_1041425817 30 Left 1041425808 8:57719070-57719092 CCACATCAAGCTGGCCCTTAGAA No data
Right 1041425817 8:57719123-57719145 CAAAATCAATGGAACCTGATTGG No data
1041425810_1041425817 16 Left 1041425810 8:57719084-57719106 CCCTTAGAAAACTGGTAACCTAG No data
Right 1041425817 8:57719123-57719145 CAAAATCAATGGAACCTGATTGG No data
1041425813_1041425817 -2 Left 1041425813 8:57719102-57719124 CCTAGAAGGATATTATGCCTCCA No data
Right 1041425817 8:57719123-57719145 CAAAATCAATGGAACCTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041425817 Original CRISPR CAAAATCAATGGAACCTGAT TGG Intergenic
No off target data available for this crispr