ID: 1041428445

View in Genome Browser
Species Human (GRCh38)
Location 8:57750116-57750138
Sequence GTGTAAATAAATAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 378}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041428440_1041428445 12 Left 1041428440 8:57750081-57750103 CCAATATTTTGTATAACATAGAA 0: 1
1: 0
2: 3
3: 43
4: 500
Right 1041428445 8:57750116-57750138 GTGTAAATAAATAATGAGGAAGG 0: 1
1: 0
2: 2
3: 30
4: 378
1041428439_1041428445 16 Left 1041428439 8:57750077-57750099 CCTGCCAATATTTTGTATAACAT 0: 1
1: 0
2: 4
3: 38
4: 376
Right 1041428445 8:57750116-57750138 GTGTAAATAAATAATGAGGAAGG 0: 1
1: 0
2: 2
3: 30
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041428445 Original CRISPR GTGTAAATAAATAATGAGGA AGG Intergenic
901321328 1:8341909-8341931 ATGTAAATAAATAAATAGGCCGG + Intronic
903410415 1:23138558-23138580 CTGAAATTAAATAATGATGATGG + Intronic
903552288 1:24166281-24166303 GTATAAATGAATAATAAGAAAGG - Intronic
904218139 1:28941074-28941096 GTGAAGTTAAATAATGAAGAAGG + Intronic
905628218 1:39502745-39502767 ATATAAATAAATAATTAGGCTGG + Intronic
905856792 1:41319834-41319856 CTGTAAATGAAAAATGAGGAGGG - Intergenic
906739401 1:48167402-48167424 GTGAAAAAAAAGAATGAAGAGGG - Intergenic
907352766 1:53846652-53846674 GTATAACTAAAAAAAGAGGAAGG - Intergenic
909963484 1:81878438-81878460 TTGTAAATAATTAATGAAAAAGG + Intronic
910905288 1:92170922-92170944 TTGCAGATATATAATGAGGAAGG - Intronic
911399405 1:97356253-97356275 GTTTGAATAAAAAATGAGCAAGG - Intronic
911714058 1:101110293-101110315 ATATAAACAAATAATGAGTATGG - Intergenic
911790447 1:102009167-102009189 CTGGAAATAAATAGTGATGATGG + Intergenic
911816899 1:102364370-102364392 GAGTAAATACATAATGATAAAGG + Intergenic
911841740 1:102690711-102690733 TTGTAAATAATTAATAATGAAGG - Intergenic
912309711 1:108607838-108607860 CTGTAAATAAAAAATAATGAAGG - Intronic
912982457 1:114387900-114387922 GGGTAAATTAATAATGAGGCTGG - Intergenic
914336038 1:146715746-146715768 TTGAAAATAAAACATGAGGAGGG + Intergenic
914878301 1:151528745-151528767 CTGTAATTAAATAGTGATGATGG - Intronic
915384119 1:155473794-155473816 GTCTTAATAAATAAAGAGGCTGG - Intronic
916533147 1:165677560-165677582 ATCAAAATAAATAATGAGGCTGG + Intronic
916829053 1:168472571-168472593 ATCCAAATAAAAAATGAGGATGG - Intergenic
918300269 1:183197710-183197732 AAGTAAATAAATAAAGTGGATGG + Intronic
919451482 1:197776777-197776799 CTGTTAGTAAAAAATGAGGACGG + Intergenic
920288874 1:204902292-204902314 GTGTAAAGAAAAAAAGAGGGAGG + Intronic
920600626 1:207321130-207321152 GGGGAAATAACTAAGGAGGAAGG - Intergenic
921682639 1:218052579-218052601 GTGTAGCTAAGAAATGAGGAAGG + Intergenic
922077692 1:222264138-222264160 GTGGAGATAAACCATGAGGAAGG - Intergenic
922456396 1:225777128-225777150 AAGTAAATAAATAAAGAAGATGG - Intergenic
923298099 1:232614398-232614420 ATGTATATAAATTCTGAGGATGG - Intergenic
924533983 1:244918642-244918664 GTTTAAAGAAATAATGAGGCCGG + Intergenic
1064053387 10:12077679-12077701 ATGTCAATGAAGAATGAGGAGGG + Intronic
1066182628 10:32978254-32978276 AAATAAATAAATAATGATGATGG - Intronic
1066516969 10:36173361-36173383 GTCTAAATGAAAAAAGAGGAAGG + Intergenic
1068253592 10:54477071-54477093 ATGTAAATAAATTATCAGGGAGG - Intronic
1068343847 10:55744688-55744710 GTGCATATAACTAATGAGGAGGG + Intergenic
1068421793 10:56804019-56804041 GTAAAAATAAAGAATCAGGAAGG - Intergenic
1069507319 10:69012350-69012372 GCATAAATTAATAATGATGATGG - Intronic
1069992586 10:72324412-72324434 GTCTCAAAAAATAATAAGGAAGG - Intergenic
1071060246 10:81561527-81561549 GAGTAAAGAAATAATGAGAGAGG - Intergenic
1072014577 10:91334320-91334342 GTGAACATAAAGAATGAGGTGGG + Intergenic
1073363895 10:102920843-102920865 ATGTAAACAAATAGTGAAGAAGG - Intronic
1073464894 10:103688865-103688887 CTCTAAATAAATAAATAGGAAGG - Intronic
1074733017 10:116397703-116397725 GTGGAGATTTATAATGAGGAAGG + Intergenic
1077426849 11:2484459-2484481 ATGAAAATAAATAATGAGGCTGG - Intronic
1079496705 11:21052575-21052597 GTATGAAGAAATAGTGAGGAAGG + Intronic
1079771540 11:24466421-24466443 GTGTAAATAATTAATTAGTATGG - Intergenic
1080120982 11:28676849-28676871 AGGTAAATAAGCAATGAGGAGGG - Intergenic
1080597159 11:33783397-33783419 GTATAATTAAATAAAGAGGTAGG - Intergenic
1081496446 11:43616018-43616040 GTGTAAAAAAATGAAGAGAAGGG + Intronic
1083422224 11:62560475-62560497 GGGTCAATCAATAAGGAGGAAGG + Intronic
1084439216 11:69161706-69161728 GGATAAATGAATAATGATGATGG + Intergenic
1084583985 11:70044544-70044566 ATGGAAATAAATAATGAAGAAGG + Intergenic
1086597905 11:88595892-88595914 GTGTAAATAAAAAATAAATACGG - Intronic
1087672488 11:101124738-101124760 CTGTAAATAAATAATGTCAATGG + Intronic
1088098473 11:106127784-106127806 GAGTAAATAAATAACGTGAAAGG + Intergenic
1089084606 11:115806392-115806414 TTGGAAATAAATAAAGATGAAGG + Intergenic
1090109334 11:123887820-123887842 GAGCAAATAAATAATGATAAAGG + Intergenic
1091965882 12:4741248-4741270 TTGGAAATAAAAAAAGAGGAAGG - Intronic
1092318360 12:7443381-7443403 GTGGAAATAAAGAATCACGAAGG - Intronic
1092518802 12:9244648-9244670 TTTTTAATAAAAAATGAGGATGG - Intergenic
1093169667 12:15845627-15845649 GTGTTAATAAAAAACAAGGAGGG - Intronic
1093757986 12:22874195-22874217 GTGTAGAGAAAGAAGGAGGAGGG - Intergenic
1095127244 12:38494618-38494640 GTGTATATTATTAATGAGGTGGG - Intergenic
1095490603 12:42729524-42729546 GTATAAATAACTTATAAGGATGG - Intergenic
1095613274 12:44157574-44157596 TTTTAAAAAAATAATGAGGTCGG + Intronic
1097004249 12:55903631-55903653 CGGTAAATAAATAATGAGAGAGG - Intronic
1097200930 12:57277967-57277989 GAATAAAAAAATAAAGAGGAAGG + Intronic
1097879886 12:64677120-64677142 GTGTAAATGAAGAATGAGGAAGG - Intronic
1098610887 12:72456491-72456513 GAAAAAACAAATAATGAGGAAGG + Intronic
1099906093 12:88771991-88772013 CTGTAAATAAATATTGAAAATGG + Intergenic
1100263281 12:92952296-92952318 GTGTAAATAATTATTGAAGCTGG - Intergenic
1100501863 12:95182134-95182156 TTAGAAATAAATAATGAGGTTGG + Intronic
1102695499 12:114796059-114796081 GAATAAATAAATAAAGAGGAAGG - Intergenic
1104501212 12:129287326-129287348 ATGTAAATTAATAAACAGGAAGG + Intronic
1104617944 12:130285893-130285915 ATGTAAAAAAATAAAGAGGCTGG - Intergenic
1105600818 13:21885483-21885505 ATGTGAACGAATAATGAGGATGG - Intergenic
1106169504 13:27276644-27276666 ATTAAAATAAATACTGAGGAAGG + Intergenic
1106787868 13:33124979-33125001 CTCTAAATTAAAAATGAGGAGGG + Intronic
1107361662 13:39624956-39624978 GGGAAAATAAATGATGGGGAAGG - Intergenic
1108715661 13:53075547-53075569 GTGTAAATCAGCAATGAGAAGGG + Intergenic
1108868629 13:54953425-54953447 ATCTAAATAAATAATGCTGAGGG + Intergenic
1108896148 13:55331597-55331619 AAATAAATAAATAATGGGGAGGG + Intergenic
1109208923 13:59512420-59512442 GAGTAAATATATAATGGGGTGGG + Intergenic
1109444109 13:62410635-62410657 GAGTAATTAGATCATGAGGATGG + Intergenic
1110654710 13:77984147-77984169 TTGTAAATAAATAATGGAGCTGG - Intergenic
1111293460 13:86198658-86198680 GTGTAATTAAGTCATGAGGGTGG + Intergenic
1111390601 13:87589926-87589948 TTGTAAATATATAGAGAGGAAGG + Intergenic
1111734869 13:92125365-92125387 ATATAAATAAATAATAAAGATGG + Intronic
1111907633 13:94273348-94273370 GTGCAAGTTAATAAAGAGGAAGG + Intronic
1113172165 13:107517063-107517085 AAGAAAATAAATAATGAGGAAGG - Intronic
1113178646 13:107598820-107598842 GAGTAAGTAAATAATGATAATGG - Intronic
1114918267 14:27293755-27293777 GTGTAAATAAATAAATAATAAGG - Intergenic
1115147234 14:30239621-30239643 GAGTAAAAATATAAGGAGGAGGG - Intergenic
1116024463 14:39498116-39498138 AGGTAAATGAATAATGGGGATGG - Intergenic
1116328048 14:43559059-43559081 TTCTAAATTAATAATGAAGATGG - Intergenic
1117947677 14:61046677-61046699 GTAAAAATAATTAAGGAGGAAGG - Intronic
1118630395 14:67697211-67697233 CTGTAAATAAATCATGGTGAAGG + Intergenic
1119373701 14:74170279-74170301 GAATAAATAAATAAAGAGGTAGG + Intronic
1119530348 14:75355672-75355694 GGTTAAATAGAAAATGAGGATGG - Intergenic
1119940485 14:78635848-78635870 GAGTATATAAGTAATTAGGATGG - Intronic
1120352357 14:83379063-83379085 GTGGAAATATATACAGAGGAAGG - Intergenic
1121032412 14:90670413-90670435 GTGGAAATAGATAGTGATGATGG + Intronic
1121184693 14:91956415-91956437 GTGTAAAGAAATAGAAAGGAGGG + Intergenic
1122615532 14:103015323-103015345 GTGTATAAAAATAATTAGGCTGG + Intronic
1123217592 14:106826261-106826283 TTTTAAAGAAAAAATGAGGAGGG + Intergenic
1124227990 15:27912582-27912604 ATGTAAATAAATAAAGGAGAAGG + Intronic
1125734819 15:41917413-41917435 ATATAAATAAATAAGGAGGCCGG - Intronic
1126656437 15:50982689-50982711 ATGTAAAAAAATAATAATGATGG - Intronic
1128647097 15:69385715-69385737 GTGTATATGAAGAAAGAGGATGG - Intronic
1128971041 15:72106329-72106351 ATTTAAAAAAATAATTAGGAAGG + Intronic
1129102811 15:73281814-73281836 GCATACATAAATAATGAGTAGGG + Intronic
1130785644 15:87092963-87092985 CTGTAAATAAGTAATGTAGAAGG - Intergenic
1131690212 15:94819043-94819065 GTGAATAAAAATAATGAGAAAGG - Intergenic
1131850606 15:96539290-96539312 GAGAAAATAAATAATGAGTGTGG - Intergenic
1133436514 16:5784705-5784727 GGGTAATTAAATCATGAGCATGG + Intergenic
1133471975 16:6084220-6084242 ATAAAAATAAATAAGGAGGAAGG - Intronic
1134194837 16:12151664-12151686 ATGTAAAACCATAATGAGGAGGG - Intronic
1136318713 16:29468721-29468743 GTGAAGACAAAGAATGAGGAGGG + Intergenic
1136433285 16:30208065-30208087 GTGAAGACAAAGAATGAGGAGGG + Intronic
1138599293 16:58045565-58045587 CTGGACATAAATAATGAGGGCGG - Exonic
1138683810 16:58707056-58707078 GGGTAAATAAATAAAGGGGTAGG - Intergenic
1139044062 16:63034879-63034901 ATAATAATAAATAATGAGGATGG + Intergenic
1139264865 16:65629200-65629222 CTGCAAACAAAAAATGAGGAAGG - Intergenic
1139997584 16:70995473-70995495 TTGAAAATAAAACATGAGGAGGG - Intronic
1141077064 16:81016463-81016485 ATCTAAATAAATAATGTGGCTGG + Intronic
1142942732 17:3396343-3396365 GTGAAAATAAATCAGGAGGAGGG + Intergenic
1142988356 17:3711678-3711700 AAATAAATAAATAATGAGGCCGG - Intergenic
1144382021 17:14709230-14709252 TTGGAAATAGATATTGAGGAAGG + Intergenic
1144685728 17:17224871-17224893 GAGTAAGTATGTAATGAGGAGGG - Intronic
1145852371 17:28113143-28113165 GTGTTACTAAATAATTAGAAAGG - Intronic
1149248158 17:54736127-54736149 TTGTAAATATATAGTGTGGAGGG + Intergenic
1150538484 17:66071590-66071612 TGGTCAATAAATAATGAGGTAGG - Intronic
1151709417 17:75793656-75793678 CTGTGAATAAAGAATAAGGAAGG - Intronic
1152253418 17:79223665-79223687 CTATGAATAAATAATGATGAAGG + Intronic
1152619235 17:81353220-81353242 GTGAAAATAAATAATGAGTTGGG - Intergenic
1153079019 18:1198404-1198426 GTTCAAATAAAAAAAGAGGATGG - Intergenic
1159182757 18:64930362-64930384 GTCTAAAGAAATCATCAGGAAGG + Intergenic
1159318662 18:66816020-66816042 GTGGAAATAGATAAGCAGGAAGG + Intergenic
1159377296 18:67609241-67609263 GTATATATAAATTATGAGTATGG - Intergenic
1159475018 18:68910286-68910308 GTCTAAATAAATAAATAAGATGG + Intronic
1159580820 18:70232774-70232796 CTGTAAATAATTGATGGGGAAGG - Intergenic
1161904353 19:7144393-7144415 AAATAAATAAATAAGGAGGATGG - Intronic
1162580984 19:11530154-11530176 CAGTAAATAAATAAATAGGAAGG + Intergenic
1163048317 19:14661668-14661690 GATTCAATAAAAAATGAGGAAGG + Intronic
1164442702 19:28291471-28291493 GTGCAAATAAATAAAGTGGTTGG + Intergenic
1165111628 19:33505757-33505779 GTGTGAGTAAATAATGTGTAGGG - Intronic
1165284493 19:34830096-34830118 ATGTAAATAGAAAATGAGCAAGG + Intergenic
1165550813 19:36583599-36583621 GAGTAAATAAATAATAAAGTTGG + Intronic
1166114165 19:40642543-40642565 CTGTAAATAAAGAAGGAAGAGGG + Intergenic
1166908861 19:46136438-46136460 GTGTAAAAAAATAACAAGAAAGG + Intergenic
925747811 2:7059044-7059066 GTTTAAAAAAATACTGTGGATGG + Intronic
926070333 2:9883711-9883733 GAGAAAACCAATAATGAGGATGG + Intronic
926260936 2:11260487-11260509 GTGTAAATATATATAGAAGAAGG - Intronic
926525649 2:13976669-13976691 ATGTAGATAAATAAGGAAGAAGG + Intergenic
926571273 2:14532826-14532848 GTGGAAATAAATAGTGAACAAGG + Intergenic
927913232 2:26916127-26916149 GTGAAAATAAATAACGGGGGAGG - Intronic
928810380 2:35217469-35217491 GTGTAAATAAATAAAGGGATTGG + Intergenic
930630358 2:53746779-53746801 TTGTAAAAACATAATGTGGAAGG - Intronic
930741771 2:54838908-54838930 GTGGTTTTAAATAATGAGGATGG + Intronic
931909502 2:66882298-66882320 GTGTAAATATATATTAATGATGG + Intergenic
932212973 2:69947248-69947270 GAGTAAAGAGATAATCAGGATGG + Intergenic
932285616 2:70529458-70529480 GTGTAAATAAATAGTCATCATGG + Intronic
932427894 2:71654480-71654502 GTTTAAAAAAATAATGTTGATGG + Intronic
933626095 2:84601447-84601469 GAGAAAATTAATAATGATGAAGG - Intronic
933897500 2:86824968-86824990 ATGCCAATAAATAATGATGATGG + Intronic
935043389 2:99456384-99456406 GTGCAAATAAATGAAGAGGAAGG + Intronic
935823659 2:106919445-106919467 TTGTAAATAAATCAGGAGAATGG - Intergenic
937487903 2:122334864-122334886 AGGTAAGTAGATAATGAGGATGG + Intergenic
937832840 2:126442734-126442756 GTTTAAAAAAATAATAATGATGG - Intergenic
938546915 2:132341753-132341775 GTGTAAATAAACTAGGAAGACGG + Intergenic
939229618 2:139409524-139409546 GTGAAAAAAAATTATGTGGAAGG + Intergenic
941196637 2:162460369-162460391 TTTTAAAAAAATATTGAGGATGG + Intronic
941412270 2:165174044-165174066 GTCTAAATAAATAAATAGGTTGG - Intronic
942640791 2:178058889-178058911 GTCAAGATAAATAATGAGAATGG - Intronic
943138361 2:183944812-183944834 GTTTAATTAAATAATGATTAAGG + Intergenic
945539862 2:211072078-211072100 GTCTAAATCCATACTGAGGAAGG - Intergenic
946645827 2:221832746-221832768 GTGTAATTAATTATTGAGGGAGG - Intergenic
947378541 2:229522653-229522675 GTATAAATTACTAATGAGAAGGG + Intronic
947923370 2:233898967-233898989 CTGTAAAAAAATGATGAAGATGG - Intergenic
949080793 2:242097542-242097564 GTGTAAGTAAATAATCTGGCTGG + Intergenic
1172083654 20:32361341-32361363 CTCTAAAAAAATAATGAGGCTGG + Intronic
1172569394 20:35957252-35957274 CAGTAAAAAAATAATGTGGAGGG + Intronic
1173633463 20:44533905-44533927 GGGTAAATAAATATGGAGGTCGG + Intronic
1177011940 21:15741017-15741039 GTGTTGATAATTAATGAGAAAGG - Intronic
1177605341 21:23370602-23370624 ATGTAAATAAATAATAATTAGGG + Intergenic
1178226277 21:30722866-30722888 TTGTAAAAAGAGAATGAGGATGG - Intergenic
1179827461 21:43974571-43974593 GTGTATATAAATCGTGAGGGTGG + Intronic
1180660017 22:17459074-17459096 GTGTAACTCAATAATCAGAAGGG - Intronic
1182105026 22:27682894-27682916 GTGGAAATTAAAAAGGAGGAGGG + Intergenic
1182168916 22:28206796-28206818 GAGTAAAGTACTAATGAGGATGG - Intronic
1183023679 22:35047854-35047876 GTGCAAATAAATACTAAGAATGG - Intergenic
1183446556 22:37860031-37860053 GTGTATATAAATAATACAGATGG - Intronic
949168600 3:971046-971068 GGGAAAATAAATAAAGAGGAGGG - Intergenic
949237541 3:1828251-1828273 GTCCATATAAATAAGGAGGATGG - Intergenic
949811342 3:8009859-8009881 GAATCCATAAATAATGAGGATGG - Intergenic
950149657 3:10676815-10676837 GCTTAAATAAATTATGCGGAAGG + Intronic
951195231 3:19816082-19816104 GTGGCAATAAATAATGAGACTGG + Intergenic
951277229 3:20703082-20703104 GTGTAAAATAATATAGAGGAAGG - Intergenic
951647168 3:24905690-24905712 GTGAGACAAAATAATGAGGAAGG + Intergenic
952100165 3:30001724-30001746 ATGTGAAGAAATAATGAGTATGG - Intronic
952294981 3:32053676-32053698 ATTAAAAAAAATAATGAGGATGG + Intronic
952580091 3:34823296-34823318 CTTTAAATAAATAATGTTGAGGG + Intergenic
955559866 3:60177200-60177222 ATTAAAATAAATAATAAGGAGGG + Intronic
956171947 3:66439975-66439997 GGGGAAATAAATATTGAGGCTGG - Intronic
956829663 3:73033615-73033637 CTGGAAATGAATAATGATGATGG - Intronic
957691859 3:83581061-83581083 GCCTAAAGAAAAAATGAGGATGG + Intergenic
958950333 3:100409346-100409368 TTGTAAATAAATAAATAGGCTGG + Intronic
959561094 3:107782386-107782408 GTGTATATATATAAAGAGCAAGG - Intronic
961374138 3:126451135-126451157 GTGTAATTAAAACATGAAGATGG - Intronic
961538728 3:127586330-127586352 GAATAAATAAATAATGGGGTGGG - Intronic
962914671 3:139888981-139889003 ATGTAGATAAATGATGAAGAAGG - Intergenic
963278228 3:143354198-143354220 ATGAAATTAAATAATGAGAAGGG - Intronic
963837466 3:150071553-150071575 GTGAAAACCAATAATGAGCAGGG + Intergenic
964224555 3:154383167-154383189 CTGAAAATAAATAGTGAGGCTGG + Intronic
964973826 3:162595667-162595689 GTTTAAGTAAATAATGATAACGG - Intergenic
965391298 3:168107659-168107681 CTGTAAATGACTAATAAGGATGG + Intergenic
965946746 3:174251738-174251760 GTATAAATACATAATGTAGATGG - Intronic
966165772 3:177014756-177014778 GTATAAAAAAATTATGCGGAGGG + Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
968249026 3:197188226-197188248 GGGTAAATAAATACAGTGGAAGG - Intronic
969625296 4:8301088-8301110 GTGTGAATCAATAATAAAGATGG - Intronic
970300336 4:14674700-14674722 GGGTAATTGAATCATGAGGATGG - Intergenic
970377255 4:15471452-15471474 GTGGAAAAAAGGAATGAGGAGGG - Intronic
971120587 4:23700252-23700274 TAGTAAACAAATGATGAGGAAGG + Intergenic
972299776 4:37773761-37773783 GAGGAAATACATGATGAGGAAGG + Intergenic
972636239 4:40886533-40886555 CTGTAAAAGAATAAGGAGGAAGG + Intronic
972910229 4:43806960-43806982 GTGTAAATAAAGTATAAAGAGGG - Intergenic
973010465 4:45066431-45066453 GTGCAGATAATTAATGAGGTGGG + Intergenic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973791089 4:54378866-54378888 GTTTAAATAAGTAATAAGGGTGG - Intergenic
975122199 4:70740600-70740622 CTGTAAAGTAATAATGTGGATGG + Intronic
975456612 4:74598093-74598115 GGGTAATTAAATCATGAGGGCGG + Intergenic
976961170 4:90976692-90976714 CTGTAAATAAATAAAAATGAAGG + Intronic
977169472 4:93742926-93742948 CTAGAAATAATTAATGAGGAAGG + Intronic
977411229 4:96667867-96667889 GAATAAATAAATAATGAGCATGG + Intergenic
977801608 4:101240732-101240754 ATTTAAAAAAATAATAAGGATGG + Intronic
978336039 4:107670339-107670361 GTACAAATAAATTAGGAGGAAGG + Intronic
978806008 4:112801103-112801125 GTGTGAATTCAGAATGAGGAGGG + Intergenic
978835487 4:113144679-113144701 ATGCAAATAACAAATGAGGAAGG + Intronic
978988530 4:115047626-115047648 TTTTAATTTAATAATGAGGATGG + Intronic
979210527 4:118095708-118095730 GTGCAACTGATTAATGAGGATGG - Intronic
979414161 4:120416247-120416269 AGGTAATTAAATAATGGGGATGG + Intergenic
980143539 4:128951103-128951125 GTGTAAATAAATAGTATAGATGG + Intronic
982306739 4:153940242-153940264 GTTTAAAGAACTACTGAGGATGG - Intergenic
983107351 4:163704358-163704380 TTGTAAATAAAAAATAAGCAAGG + Intronic
983304600 4:165970464-165970486 GAGAAAATAAATATTGAGTATGG - Intronic
983699746 4:170577905-170577927 GGGTAATTGAATCATGAGGATGG - Intergenic
984228800 4:177068279-177068301 TTATAAATAAATAATTAAGATGG - Intergenic
984501219 4:180561652-180561674 GTGTAAATATATAATTGGGTAGG - Intergenic
986985820 5:13500139-13500161 GTGCAATTGTATAATGAGGATGG - Intergenic
987154045 5:15070003-15070025 TTGTAAAGGAAAAATGAGGAGGG + Intergenic
987384948 5:17320214-17320236 AAATAAATAAATAAAGAGGATGG + Intergenic
988007877 5:25441974-25441996 GTGAGATTAGATAATGAGGATGG + Intergenic
989575522 5:42984287-42984309 GAGTAAAGAAATAATTAGGTTGG - Intergenic
990047693 5:51454776-51454798 GCCTAAATCAATAATGATGAAGG - Intergenic
992058561 5:73018855-73018877 GTGTACATAATTATTTAGGAAGG - Intronic
992249531 5:74864149-74864171 GTTTAATTTAATAAGGAGGATGG + Intronic
992532998 5:77670491-77670513 ATGTGATTAAATCATGAGGAAGG - Intergenic
992647138 5:78821464-78821486 GTTTAAACAAATAATGAAAATGG + Intronic
993004138 5:82412703-82412725 CCATAAATAAATAATGGGGAGGG - Intergenic
993487691 5:88506658-88506680 GTGTAAAGAAAGTAGGAGGAGGG - Intergenic
993562520 5:89428508-89428530 GTGTGAATACATACTGATGAAGG + Intergenic
994655167 5:102583720-102583742 GTGAAAATAAATATTCTGGAGGG - Intergenic
995585547 5:113644368-113644390 AAATAAATAAATAATTAGGAAGG - Intergenic
995835550 5:116396461-116396483 GTGTAAAGAAATACTGAGGGAGG - Intronic
996286449 5:121798710-121798732 GTATTAATAAATGAGGAGGAAGG + Intergenic
996452884 5:123646892-123646914 ATGGAAAAAAATAATGAGGGAGG - Intergenic
996730786 5:126715570-126715592 GACTAAATAAAGACTGAGGAAGG + Intergenic
997066027 5:130559951-130559973 TTGTAAATAATTGAGGAGGAGGG + Intergenic
997338588 5:133124861-133124883 GTATAAATAAACAATGAACAAGG - Intergenic
1000093402 5:157949642-157949664 GTCTAATTAACTAATGGGGATGG + Intergenic
1000232663 5:159330637-159330659 GTGTGTATCAATAACGAGGAGGG + Exonic
1000444781 5:161306136-161306158 GTCTCAAAAAGTAATGAGGATGG + Intronic
1000693634 5:164352797-164352819 GTGTGAATAAATTAGGGGGATGG - Intergenic
1000972150 5:167726441-167726463 AAGTAAATAAATAAAAAGGAAGG - Intronic
1001001388 5:168010639-168010661 TTGTAAGTAAATGATGATGAAGG + Intronic
1001186124 5:169574595-169574617 GTGTAAAAAAAAAATGTGAAGGG + Intergenic
1001233278 5:170008407-170008429 GTGTGAATAATTTATGAAGATGG - Intronic
1001585402 5:172830765-172830787 GGAAAAAAAAATAATGAGGATGG + Intergenic
1003414944 6:5899040-5899062 GTGTAGATATACTATGAGGATGG - Intergenic
1003914961 6:10778281-10778303 AAGTAAATACATAATGAGCAGGG + Intronic
1004159197 6:13198378-13198400 GAGGCAATTAATAATGAGGATGG + Intronic
1004573505 6:16870622-16870644 ATGCAAATAAAGAATGAGGGAGG - Intergenic
1004963712 6:20822640-20822662 AGGTAAATGAATTATGAGGATGG + Intronic
1005031779 6:21515567-21515589 GTGTAAATAAATTCTGAGATTGG - Intergenic
1007283979 6:40734406-40734428 AAATAAATAAATAAAGAGGAAGG - Intergenic
1009935062 6:70224196-70224218 GTGTAAGTAAATTGTGAGGCAGG - Intronic
1010715222 6:79221362-79221384 GTGTAAAGAAAGAATGGGGATGG - Intronic
1010751360 6:79619390-79619412 GTAACAATAAAGAATGAGGAAGG - Intergenic
1010935351 6:81853914-81853936 GTGTAAATATGGAATGGGGAAGG + Intergenic
1011693750 6:89893323-89893345 GTTAAAATAGATAATGAGGCTGG - Intergenic
1012076688 6:94696326-94696348 ATATAAACAATTAATGAGGAAGG - Intergenic
1012159054 6:95859939-95859961 CTGGAAATAAATAATGATGAAGG - Intergenic
1013670802 6:112400230-112400252 GTGGAATTAGAGAATGAGGAAGG - Intergenic
1013788109 6:113805874-113805896 ATATGAATAAATACTGAGGAGGG + Intergenic
1013865872 6:114695290-114695312 GTGTAATTAGATCATGAGGGTGG + Intergenic
1014535377 6:122607643-122607665 GTGTAAATAGTTTATGAGGTTGG - Intronic
1015109165 6:129571424-129571446 GTGTACATATATATTTAGGATGG - Intergenic
1016087514 6:139932585-139932607 TTGTTAAAAAAAAATGAGGAAGG - Intergenic
1017453167 6:154573606-154573628 GTGGAAATAGCTAATGAGGCCGG - Intergenic
1018425940 6:163680560-163680582 TTATAAATAAATAAATAGGAAGG - Intergenic
1019836659 7:3392538-3392560 TTGGAAATAAATAATGGTGATGG - Intronic
1020344621 7:7149537-7149559 TTTTAAATAAATAATAATGAGGG + Intergenic
1020850792 7:13350276-13350298 CTATAAATAAATAATGAGACGGG + Intergenic
1021241835 7:18211782-18211804 GTGAGAGTAAATAATGTGGAGGG + Intronic
1021437905 7:20642233-20642255 GTGGTAAGAAATAATGAGGCTGG - Intronic
1021854069 7:24836419-24836441 GTGTTAATACATAAATAGGAAGG - Intronic
1023234408 7:38068673-38068695 TTGAGAATAAATAATGAAGAGGG - Intergenic
1024542975 7:50494104-50494126 GTTTAAAGAAATAATGATGATGG - Intronic
1024593665 7:50913784-50913806 GTGTGAATAAATGATGGAGAAGG - Intergenic
1024624749 7:51196535-51196557 AAATAAATAAATAAAGAGGAAGG - Intronic
1025872654 7:65449268-65449290 GAGTAAATAAATAAAAAGAAAGG - Intergenic
1027451001 7:78331374-78331396 GTATAAAAAAATAATGCAGATGG + Intronic
1027630021 7:80592852-80592874 GAGTAAATACATAAAGTGGAAGG + Intronic
1027770047 7:82394927-82394949 GTATAAAAAAATAATGAAGCTGG - Intronic
1027783962 7:82555703-82555725 ATGGAAATAAAAAATGAGCAGGG + Intergenic
1027805776 7:82820233-82820255 ATGTAAATAAATAATGGGATTGG - Intronic
1027904814 7:84165936-84165958 GTGAAAATATAAAATGTGGAGGG + Intronic
1028579236 7:92387924-92387946 TTGTGAATAAATAAAGAGAATGG + Intronic
1028715998 7:93969495-93969517 GTGGATATGAATAATCAGGAAGG + Intronic
1029962318 7:104700987-104701009 GTGTAAACAAAGAAAGATGAAGG - Intronic
1031445714 7:121851206-121851228 GTGTAAATAAAAAATTATAAAGG + Intergenic
1031670441 7:124536552-124536574 ATGTAAATAAATAAAAATGAGGG - Intergenic
1032585023 7:133138429-133138451 ATTTAAAAAAAAAATGAGGAAGG - Intergenic
1032924329 7:136585678-136585700 TAGTAAATAAAAAAGGAGGAAGG + Intergenic
1032945496 7:136847414-136847436 GTGGAATAAAATAATGAAGAAGG + Intergenic
1032976985 7:137236451-137236473 CTGTAAATAACAAATAAGGATGG - Intronic
1033250146 7:139751716-139751738 GAGTAAATAATTAATGACTAAGG + Intronic
1033520629 7:142156997-142157019 GTGCAAATAAATTATGACGATGG - Intronic
1033724635 7:144101404-144101426 GAGTAAATCAAAAAAGAGGATGG - Intergenic
1034736690 7:153435367-153435389 TTGGAAATAATTAATAAGGAAGG + Intergenic
1034902923 7:154918735-154918757 GTGTGAATGAAGAATGAGGAGGG + Intergenic
1035538835 8:415717-415739 GTGTAAGTAAATAATCTGGCTGG + Intronic
1036617048 8:10396294-10396316 GTGTAAATAAAAAAGAAGTAAGG - Intronic
1038172633 8:25151326-25151348 AAATAAATAAATAATGTGGATGG + Intergenic
1038764493 8:30414746-30414768 GGGAAAATAAAGTATGAGGAAGG + Intronic
1038988291 8:32837408-32837430 ATGTAAATAAGTAATAAGGACGG - Intergenic
1039209329 8:35194707-35194729 TTAGAAATAAATAATGAGGTGGG + Intergenic
1039842665 8:41304832-41304854 GTGTCAATAAAAACTAAGGATGG - Intronic
1040861533 8:52004442-52004464 GTCTAAATAAATAATGTGGAAGG + Intergenic
1040892518 8:52332375-52332397 GTGTAAAGAAACACTGAGCAAGG - Intronic
1041326050 8:56665811-56665833 GTGTAGATGAATGATGAAGAGGG + Intergenic
1041346431 8:56902973-56902995 GGGTAAAGAAATAAAGAGAAAGG + Intergenic
1041428445 8:57750116-57750138 GTGTAAATAAATAATGAGGAAGG + Intergenic
1041718460 8:60953247-60953269 GTGTACATAAAGCATGAGCAGGG - Intergenic
1041958732 8:63586712-63586734 GTGTAAATAAATAGCGAGATAGG + Intergenic
1042404102 8:68383715-68383737 GTCAAAATAAATAATCAGGATGG - Intronic
1042433665 8:68738891-68738913 TTCTAAAAAATTAATGAGGAGGG + Intronic
1042626930 8:70768616-70768638 GGGCAAATATATAATTAGGATGG + Intronic
1042885278 8:73542613-73542635 GTGTAAATCAATAATTATGGGGG + Intronic
1043114194 8:76228650-76228672 TAATAAATAAATAATGAGGAAGG + Intergenic
1044194487 8:89358148-89358170 GTGAAAATAAATAATAAGGGAGG - Intergenic
1044326411 8:90864274-90864296 GTGGAAAAAAAAAACGAGGAAGG + Intronic
1045717181 8:105061401-105061423 TTTTAAATAAATAATGATGTGGG + Intronic
1046039803 8:108888724-108888746 CTGATAATATATAATGAGGAAGG - Intergenic
1046333672 8:112755028-112755050 AGGTAATTAAATAATGAGGGCGG + Intronic
1046408918 8:113813224-113813246 GAGTGAATAAATGAGGAGGATGG - Intergenic
1046503081 8:115103844-115103866 CTGAAAGTAAATATTGAGGAAGG - Intergenic
1048947814 8:139466405-139466427 GTGTTATTAAATAGTAAGGATGG + Intergenic
1050113068 9:2236424-2236446 GTGAAAATACATATTGAGGCCGG + Intergenic
1050524559 9:6534259-6534281 GTATAAAAACATAATGAGAATGG - Intronic
1050854643 9:10337238-10337260 GTGTACATATATAATAATGAGGG - Intronic
1051841995 9:21408878-21408900 GTGTTATTAAATTATCAGGAGGG + Intergenic
1052162481 9:25282978-25283000 GGGTAAATTAATAATGACAAAGG - Intergenic
1052233542 9:26183719-26183741 GTGAAAATACAAAATGAGGGAGG - Intergenic
1054888660 9:70228323-70228345 GTGTAAATTGACATTGAGGATGG - Intergenic
1055258554 9:74403813-74403835 GCATAAATAAAAAATGAGAATGG - Intergenic
1055514917 9:77024173-77024195 GTGTAAATAAACAAGGGGGCGGG + Intergenic
1056119682 9:83475072-83475094 CTGTAAATAAAAAATGATGGAGG - Intronic
1056538797 9:87553790-87553812 TTGAAAATAAATATTGAGGCCGG - Intronic
1056898286 9:90572255-90572277 ATGTACATACATAAAGAGGAAGG + Intergenic
1057301278 9:93885423-93885445 TTGGAAATAGATAATGATGATGG + Intergenic
1057483714 9:95465495-95465517 GTGTTAATAAATAATAATCATGG + Intronic
1057504772 9:95624873-95624895 GTTTAAATAAATAATCAAAAAGG - Intergenic
1059070721 9:111133046-111133068 GTTTAAATAAATACTTAGCAGGG - Intergenic
1059772303 9:117438842-117438864 GTAGAAAGAAATAAGGAGGAAGG - Intergenic
1059986026 9:119821484-119821506 ATGAAAATAAAGGATGAGGAAGG - Intergenic
1061224045 9:129270243-129270265 GGGTAAATAAATAATGATAACGG - Intergenic
1062065171 9:134522784-134522806 ATTAAAATAAAAAATGAGGAAGG - Intergenic
1186755539 X:12667507-12667529 GTATAAATATAAAATGAGAAAGG + Intronic
1188085984 X:25901833-25901855 AAGTAAATAAATAAATAGGAAGG - Intergenic
1188446523 X:30258256-30258278 GTGCAAGTTACTAATGAGGACGG - Intergenic
1188848066 X:35098660-35098682 GTGTAAATAATTCATTAGGCAGG + Intergenic
1188975523 X:36669399-36669421 GTGTAAATAATTCATTAGGCAGG - Intergenic
1189667124 X:43367460-43367482 GTGAAAATAAAAAATGATGTGGG + Intergenic
1190534266 X:51409846-51409868 GTGTGAATAAAGCATGAGCAGGG - Intergenic
1192076001 X:67997489-67997511 TTCTAAAAAAAAAATGAGGAGGG - Intergenic
1192596719 X:72417093-72417115 TTGTAAATAAATAGTGATGATGG - Intronic
1193018498 X:76763112-76763134 ATGAAAATAACTAAAGAGGACGG + Intergenic
1193260109 X:79395973-79395995 GTGTCAAGAAATAAAGAGGCTGG + Intergenic
1193552292 X:82910637-82910659 CTGGAAATAAATACAGAGGACGG + Intergenic
1193596869 X:83457451-83457473 GAGAAAATAAATATTGAAGAAGG + Intergenic
1193731656 X:85109630-85109652 GTGTAAGTGAAAAATGAGGACGG - Intergenic
1193775212 X:85633216-85633238 ATATAAATAAAGAATGATGATGG + Intergenic
1193980471 X:88175992-88176014 GGTTGAATAAAGAATGAGGAGGG - Intergenic
1194193902 X:90869097-90869119 GTATAAATAAATAGTGAGGTAGG - Intergenic
1194818111 X:98470259-98470281 GTGTAAATCCATAACAAGGATGG - Intergenic
1195398369 X:104435412-104435434 GTGTAAATAAATAATTGGCTGGG - Intergenic
1196308210 X:114128844-114128866 GTGTAAATAAAGACAGAGAAAGG - Intergenic
1196890794 X:120288786-120288808 GTGAAATTAAATAATGGGAATGG - Intronic
1196919696 X:120573132-120573154 ATGTACATAAATGCTGAGGAAGG - Intronic
1197610718 X:128635352-128635374 AGGTAGATAGATAATGAGGAAGG + Intergenic
1198371581 X:135994504-135994526 ATTTAAATAAGTAATGAGGAAGG - Intronic
1199154241 X:144527390-144527412 AGGTAATTAAATAATGATGAAGG + Intergenic
1199713419 X:150488681-150488703 GTGTGAATATCTAATGAGAATGG - Intronic
1200540513 Y:4451481-4451503 GTATAAATAAATAGTGAGGTAGG - Intergenic
1200649219 Y:5820297-5820319 GTAAAAATAAAAAATCAGGATGG + Intergenic
1200977137 Y:9225326-9225348 GTATAAATAAATAAAGATTACGG + Intergenic
1201473373 Y:14357004-14357026 GTGCAAACAAATAGTGAAGAAGG + Intergenic
1201710089 Y:16981731-16981753 TTGTAAGTAAATAATGTGAAAGG + Intergenic