ID: 1041429085

View in Genome Browser
Species Human (GRCh38)
Location 8:57758936-57758958
Sequence GGGGCAGTAATGATACAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041429085_1041429089 -3 Left 1041429085 8:57758936-57758958 CCACCTTGTATCATTACTGCCCC No data
Right 1041429089 8:57758956-57758978 CCCCAGTGCAAATGCATGCATGG No data
1041429085_1041429092 7 Left 1041429085 8:57758936-57758958 CCACCTTGTATCATTACTGCCCC No data
Right 1041429092 8:57758966-57758988 AATGCATGCATGGACACCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041429085 Original CRISPR GGGGCAGTAATGATACAAGG TGG (reversed) Intergenic
No off target data available for this crispr