ID: 1041430446

View in Genome Browser
Species Human (GRCh38)
Location 8:57776037-57776059
Sequence GCCCATGGGCAGGAGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041430446_1041430449 -10 Left 1041430446 8:57776037-57776059 CCTTCCAGCTCCTGCCCATGGGC No data
Right 1041430449 8:57776050-57776072 GCCCATGGGCCAGCCACAGCTGG No data
1041430446_1041430460 23 Left 1041430446 8:57776037-57776059 CCTTCCAGCTCCTGCCCATGGGC No data
Right 1041430460 8:57776083-57776105 ACCTCTACACCTGGGAGGGCAGG No data
1041430446_1041430457 18 Left 1041430446 8:57776037-57776059 CCTTCCAGCTCCTGCCCATGGGC No data
Right 1041430457 8:57776078-57776100 TCACCACCTCTACACCTGGGAGG No data
1041430446_1041430458 19 Left 1041430446 8:57776037-57776059 CCTTCCAGCTCCTGCCCATGGGC No data
Right 1041430458 8:57776079-57776101 CACCACCTCTACACCTGGGAGGG No data
1041430446_1041430463 27 Left 1041430446 8:57776037-57776059 CCTTCCAGCTCCTGCCCATGGGC No data
Right 1041430463 8:57776087-57776109 CTACACCTGGGAGGGCAGGGAGG No data
1041430446_1041430455 14 Left 1041430446 8:57776037-57776059 CCTTCCAGCTCCTGCCCATGGGC No data
Right 1041430455 8:57776074-57776096 ATGCTCACCACCTCTACACCTGG No data
1041430446_1041430462 24 Left 1041430446 8:57776037-57776059 CCTTCCAGCTCCTGCCCATGGGC No data
Right 1041430462 8:57776084-57776106 CCTCTACACCTGGGAGGGCAGGG No data
1041430446_1041430456 15 Left 1041430446 8:57776037-57776059 CCTTCCAGCTCCTGCCCATGGGC No data
Right 1041430456 8:57776075-57776097 TGCTCACCACCTCTACACCTGGG No data
1041430446_1041430451 -9 Left 1041430446 8:57776037-57776059 CCTTCCAGCTCCTGCCCATGGGC No data
Right 1041430451 8:57776051-57776073 CCCATGGGCCAGCCACAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041430446 Original CRISPR GCCCATGGGCAGGAGCTGGA AGG (reversed) Intergenic
No off target data available for this crispr