ID: 1041435323

View in Genome Browser
Species Human (GRCh38)
Location 8:57832606-57832628
Sequence CAGTCATATTTTGAGTTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041435319_1041435323 13 Left 1041435319 8:57832570-57832592 CCTTAATTATTTTTTTAAAGGTC No data
Right 1041435323 8:57832606-57832628 CAGTCATATTTTGAGTTGCTGGG No data
1041435320_1041435323 -9 Left 1041435320 8:57832592-57832614 CCTGTCTCCAAATACAGTCATAT 0: 20
1: 196
2: 757
3: 1448
4: 2570
Right 1041435323 8:57832606-57832628 CAGTCATATTTTGAGTTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041435323 Original CRISPR CAGTCATATTTTGAGTTGCT GGG Intergenic
No off target data available for this crispr