ID: 1041443914

View in Genome Browser
Species Human (GRCh38)
Location 8:57929437-57929459
Sequence CTGAATATACCAATGGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041443914_1041443917 30 Left 1041443914 8:57929437-57929459 CCATTATCCATTGGTATATTCAG No data
Right 1041443917 8:57929490-57929512 TTTTCCTAATTTGCATTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041443914 Original CRISPR CTGAATATACCAATGGATAA TGG (reversed) Intergenic
No off target data available for this crispr