ID: 1041444501

View in Genome Browser
Species Human (GRCh38)
Location 8:57935127-57935149
Sequence GAATCCAGACATTGCTCCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041444501_1041444503 12 Left 1041444501 8:57935127-57935149 CCTTCGGAGCAATGTCTGGATTC No data
Right 1041444503 8:57935162-57935184 ATATCTGGAAGACAAGTGTGCGG No data
1041444501_1041444504 13 Left 1041444501 8:57935127-57935149 CCTTCGGAGCAATGTCTGGATTC No data
Right 1041444504 8:57935163-57935185 TATCTGGAAGACAAGTGTGCGGG No data
1041444501_1041444505 14 Left 1041444501 8:57935127-57935149 CCTTCGGAGCAATGTCTGGATTC No data
Right 1041444505 8:57935164-57935186 ATCTGGAAGACAAGTGTGCGGGG No data
1041444501_1041444506 15 Left 1041444501 8:57935127-57935149 CCTTCGGAGCAATGTCTGGATTC No data
Right 1041444506 8:57935165-57935187 TCTGGAAGACAAGTGTGCGGGGG No data
1041444501_1041444502 -3 Left 1041444501 8:57935127-57935149 CCTTCGGAGCAATGTCTGGATTC No data
Right 1041444502 8:57935147-57935169 TTCGCTTTTGACTGAATATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041444501 Original CRISPR GAATCCAGACATTGCTCCGA AGG (reversed) Intergenic
No off target data available for this crispr