ID: 1041444502

View in Genome Browser
Species Human (GRCh38)
Location 8:57935147-57935169
Sequence TTCGCTTTTGACTGAATATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041444498_1041444502 11 Left 1041444498 8:57935113-57935135 CCATCTGAAAAGTCCCTTCGGAG No data
Right 1041444502 8:57935147-57935169 TTCGCTTTTGACTGAATATCTGG No data
1041444500_1041444502 -2 Left 1041444500 8:57935126-57935148 CCCTTCGGAGCAATGTCTGGATT No data
Right 1041444502 8:57935147-57935169 TTCGCTTTTGACTGAATATCTGG No data
1041444501_1041444502 -3 Left 1041444501 8:57935127-57935149 CCTTCGGAGCAATGTCTGGATTC No data
Right 1041444502 8:57935147-57935169 TTCGCTTTTGACTGAATATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041444502 Original CRISPR TTCGCTTTTGACTGAATATC TGG Intergenic
No off target data available for this crispr