ID: 1041445150

View in Genome Browser
Species Human (GRCh38)
Location 8:57943180-57943202
Sequence GGGCAATCCTTGGGAGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041445143_1041445150 25 Left 1041445143 8:57943132-57943154 CCTCTGTGGAAAGGAAAGTCTTA No data
Right 1041445150 8:57943180-57943202 GGGCAATCCTTGGGAGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041445150 Original CRISPR GGGCAATCCTTGGGAGAAAC TGG Intergenic
No off target data available for this crispr