ID: 1041458773

View in Genome Browser
Species Human (GRCh38)
Location 8:58088806-58088828
Sequence CTTTTTGATCAGAGGGCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041458770_1041458773 19 Left 1041458770 8:58088764-58088786 CCAAAAACTATCAAGGACAGACT 0: 1
1: 0
2: 0
3: 11
4: 186
Right 1041458773 8:58088806-58088828 CTTTTTGATCAGAGGGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041458773 Original CRISPR CTTTTTGATCAGAGGGCTCA TGG Intronic
No off target data available for this crispr