ID: 1041461313

View in Genome Browser
Species Human (GRCh38)
Location 8:58114907-58114929
Sequence CCTTGCTGCCCTTCATCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 145}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041461313_1041461320 26 Left 1041461313 8:58114907-58114929 CCCTCTGATGAAGGGCAGCAAGG 0: 1
1: 1
2: 1
3: 16
4: 145
Right 1041461320 8:58114956-58114978 ACTAGAATTCCCGAGTGCTTTGG No data
1041461313_1041461321 27 Left 1041461313 8:58114907-58114929 CCCTCTGATGAAGGGCAGCAAGG 0: 1
1: 1
2: 1
3: 16
4: 145
Right 1041461321 8:58114957-58114979 CTAGAATTCCCGAGTGCTTTGGG No data
1041461313_1041461318 -6 Left 1041461313 8:58114907-58114929 CCCTCTGATGAAGGGCAGCAAGG 0: 1
1: 1
2: 1
3: 16
4: 145
Right 1041461318 8:58114924-58114946 GCAAGGGAGATGGTCTTCGCTGG No data
1041461313_1041461322 28 Left 1041461313 8:58114907-58114929 CCCTCTGATGAAGGGCAGCAAGG 0: 1
1: 1
2: 1
3: 16
4: 145
Right 1041461322 8:58114958-58114980 TAGAATTCCCGAGTGCTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041461313 Original CRISPR CCTTGCTGCCCTTCATCAGA GGG (reversed) Intronic
904616012 1:31750290-31750312 CCATGCTGCTCTTGTTCAGAGGG + Intronic
904627080 1:31812824-31812846 CCTTGCTCCCATTCACCAGCTGG + Intronic
905742381 1:40383406-40383428 CCTTGCTCCGCTTGATCACAGGG - Intronic
906191855 1:43904164-43904186 CCCTGCTGCCTTTCACCAGGAGG - Intronic
907370852 1:54002524-54002546 CTTTGCAGCCCCTCCTCAGAAGG + Intergenic
908356550 1:63329024-63329046 CCTTGCTGCCCTCCAACAGTTGG + Intergenic
908670773 1:66544989-66545011 CCTTCCTGTCCTACATCAGTAGG + Intronic
909476767 1:76089622-76089644 ACTTGATTCCCTTCATCAAATGG - Intronic
915836220 1:159177692-159177714 CCTTTCTGCAGTTGATCAGATGG - Intronic
916238436 1:162614012-162614034 CCTGGGTGCCCTTCATCTGCTGG - Intergenic
918470256 1:184865206-184865228 CCTTGGTGCCCATCAACAGTGGG + Intronic
919838115 1:201590623-201590645 CCCTGCAGCCCTTCCTCAGCTGG - Intergenic
919842575 1:201619873-201619895 CTTTGCTGCCCTTCTTCTGCTGG + Intergenic
1063165754 10:3460333-3460355 CCCAGTTGCCCTTCATCACATGG + Intergenic
1063583091 10:7327035-7327057 CCCTGCTGTCCTTCATACGAGGG + Intronic
1069892328 10:71659808-71659830 CCTTCCTCCTCCTCATCAGATGG - Intronic
1075198527 10:120382062-120382084 CCCTTCTGCCCTTCTTGAGATGG + Intergenic
1075943072 10:126407995-126408017 CCTTGCTGGCTGTCAGCAGAGGG - Intergenic
1076188297 10:128465663-128465685 CCTTTCTGCCCTCTTTCAGAGGG + Intergenic
1080362495 11:31532184-31532206 CCTTGCTGCCCATCTTCTGGTGG - Intronic
1080640654 11:34156404-34156426 CCCTGCTGCCCTTCTACAGGTGG - Intronic
1082749450 11:57001019-57001041 CCTTGCAGCCTTTCCTGAGATGG + Intergenic
1084210237 11:67617698-67617720 CCTGACTGCCCAGCATCAGACGG - Intergenic
1084952218 11:72672879-72672901 CCTCCCTGCCCTGCATCAGTGGG + Intronic
1087468769 11:98545538-98545560 CATTTCTGCCCTTCCTCACAGGG + Intergenic
1088754568 11:112875198-112875220 CCTTGCTGCCTTTCTTCTGCTGG - Intergenic
1089795493 11:120977289-120977311 CTTTCCTTCCCTTCTTCAGATGG - Intronic
1091594409 12:1866146-1866168 CATAGGTGCCTTTCATCAGAGGG + Intronic
1096610786 12:52800053-52800075 CCTGGCAGGCCTTCAGCAGATGG + Intergenic
1100585772 12:95977978-95978000 CCTTGCTGCCCATCCTCCCATGG + Exonic
1101736279 12:107465659-107465681 CGTGGCTGCCCTTCATCACTAGG + Intronic
1103018248 12:117512888-117512910 CCTTGCTGCCCATAGGCAGAAGG + Intronic
1104621451 12:130316474-130316496 ACTTCCTGCTCTTCATGAGAAGG + Intergenic
1106337388 13:28796307-28796329 CCCTGCCGCCCTCCACCAGACGG + Intergenic
1106374358 13:29170629-29170651 CCTTGCTGCCCTCCACCCAAAGG + Intronic
1106843076 13:33707676-33707698 TCTGTCTGCCCTTCTTCAGAGGG + Intergenic
1107739070 13:43429683-43429705 CCTTGCTGCCCTTCCTAACATGG - Intronic
1109151894 13:58857685-58857707 CCTTACTGCCCTCCCTAAGATGG + Intergenic
1111538244 13:89632738-89632760 TCTTGCTGGCTGTCATCAGAGGG - Intergenic
1112158565 13:96844961-96844983 CCATCCTGCTCTTCATGAGAAGG + Intergenic
1114444976 14:22781435-22781457 CCTTTCTGCTCTTCCTGAGAAGG + Intronic
1117042090 14:51776727-51776749 CATTGCTGCCTTTCATCTGAGGG + Intergenic
1118760659 14:68878748-68878770 CCTCGCTGCTCTTCATCCCATGG - Intronic
1120745065 14:88145183-88145205 CCTTGCAGCCTTTCCTGAGATGG - Intergenic
1121017734 14:90558594-90558616 CCAGGCCTCCCTTCATCAGAAGG - Intronic
1122179319 14:99943982-99944004 CCTTACTACCCTCCTTCAGACGG - Intergenic
1122588110 14:102825347-102825369 CCTTGCTGCCCTTAATCAGATGG + Intronic
1122985800 14:105211122-105211144 CGTTGCTGCCCATCATCTGCAGG + Exonic
1126599327 15:50413292-50413314 CTTTGCTGACCTCCATCAGTAGG + Intergenic
1128694145 15:69747756-69747778 CCTTGCTGCCCTTTAGCTGAGGG + Intergenic
1130022369 15:80242192-80242214 CCTTCCTGCCTTTCAACATAGGG - Intergenic
1130900644 15:88204741-88204763 CCTCGCTTCCCTTCACCAGCAGG - Intronic
1133816887 16:9204292-9204314 CCTGGCTCCCCTTCATCAGCTGG + Intergenic
1137896597 16:52219413-52219435 CCATGCTCCCCTTCACCACAGGG + Intergenic
1138439671 16:57026503-57026525 TCTTGCTGCCCTGCACCTGATGG + Exonic
1138727515 16:59156388-59156410 CCTTGTTACCCTTGATCAAAGGG - Intergenic
1140899931 16:79358117-79358139 CCCTGCTGCCCTTCCTCTGGGGG - Intergenic
1142390653 16:89797485-89797507 CCCTGCTGTCCTTCCTCACAGGG + Intronic
1143108911 17:4542804-4542826 CCTGGCCTACCTTCATCAGAAGG + Intronic
1144672481 17:17140796-17140818 CCTTGCTGCCAGTCACCAGCAGG - Intronic
1144682316 17:17204205-17204227 ACTTCCTGCCCTTCCTCAAAAGG + Intronic
1144688131 17:17240245-17240267 GCTTGCTGCCTTTCAGCAGCTGG - Intergenic
1145898732 17:28476046-28476068 CCTTCCTGCCCTTCTCCAGTTGG + Intronic
1147421929 17:40326182-40326204 CCTTGGTGCCCCTCAGCAGTCGG - Intronic
1147430292 17:40366725-40366747 TCCTGCTGCCCTTCTTCAGAGGG - Intergenic
1148129641 17:45255119-45255141 CCTTGCTTCCCTGCAGCAGAGGG + Exonic
1151437807 17:74108960-74108982 CCTTTCTTCCCTGCACCAGAGGG + Intergenic
1151961388 17:77407765-77407787 CCTTGCTGTCCTCCCACAGAAGG + Intronic
1153961550 18:10144290-10144312 CCCTGCTGTCCTTCCTCAGATGG + Intergenic
1155806018 18:30172960-30172982 CCTTTCTGCCCTTCACCATGTGG - Intergenic
1157529952 18:48411488-48411510 TCTTGCTTCCCTTCATTAAAGGG + Intergenic
1158615293 18:58981527-58981549 CCTTGATGCCATGCATCAGCTGG - Exonic
1159027388 18:63196671-63196693 CCGTGCGGCCCTTTATCATACGG + Intronic
1160751606 19:737047-737069 CCTTGCTGCCTTTTCTGAGACGG - Intronic
1163053615 19:14702850-14702872 CCTTGCTGCCCACCATGTGAAGG - Intronic
928819133 2:35339610-35339632 CTTTGCTGTTCTTCTTCAGAAGG - Intergenic
944278998 2:197872602-197872624 CATTGCCCCCATTCATCAGATGG - Intronic
945044583 2:205770681-205770703 CTTCTCTGCCTTTCATCAGACGG - Intronic
945207714 2:207349669-207349691 CCTTGTAGCCCTTTGTCAGATGG - Intergenic
945365607 2:208949475-208949497 GCATGCAGCCATTCATCAGAGGG + Intergenic
946610551 2:221453396-221453418 CCTTGCTTCCCACCATCAGATGG + Intronic
1168819828 20:765379-765401 CCTTCCTGCCGTTCATGAGCCGG - Exonic
1170775218 20:19369258-19369280 CTGTGCTGCCCTTCATCAGGAGG - Intronic
1174065606 20:47862754-47862776 CCTTGGAGACCTTGATCAGAGGG - Intergenic
1175494699 20:59405439-59405461 CCTTCCTGCCATTCCTCAAACGG - Intergenic
1175862149 20:62156296-62156318 CCTTCCTGCAGTTCATCTGAAGG + Intronic
1176094721 20:63335197-63335219 TGTAGCTGCCCTTCATCAGAAGG + Intergenic
1179524966 21:41969973-41969995 CCTTTCTGCCCTTCACAAAAGGG - Intergenic
1180183298 21:46127484-46127506 TCTGGCTGCCCTTCAGCAGGCGG + Intronic
1180834311 22:18922226-18922248 CCTGGCTGCCCTGCCTGAGAGGG - Intronic
1181065499 22:20303877-20303899 CCTGGCTGCCCTGCCTGAGAGGG + Intergenic
1184223367 22:43114890-43114912 CCCTCCTGCCCTTTAACAGAAGG + Intronic
1203284400 22_KI270734v1_random:147525-147547 CCTGGCTGCCCTGCCTGAGAGGG - Intergenic
951845680 3:27081735-27081757 CCTTGCTCCCTTTCATCATCTGG + Intergenic
953452934 3:43019249-43019271 CCTTGCTCAGCTCCATCAGAGGG - Intronic
955870527 3:63433684-63433706 CCTTGCAGCCCTGAATCCGAGGG + Intronic
956196415 3:66657343-66657365 CCTTGCTGGCTTCCATCAGTGGG + Intergenic
957034606 3:75282173-75282195 GCTTTCTTCCCTTCAGCAGAGGG + Intergenic
957930408 3:86871373-86871395 CCTTGCTCCCCTTCCTCAACAGG + Intergenic
959254318 3:103990797-103990819 CCTTGCAGCCTTTCCTGAGATGG + Intergenic
961078474 3:124003758-124003780 GCTTTCTTCCCTTCAGCAGAGGG + Intergenic
961305001 3:125952689-125952711 GCTTTCTTCCCTTCAGCAGAAGG - Intergenic
962815594 3:138994968-138994990 CCTTGCAGCCATTCATCAAGGGG - Intergenic
963390199 3:144652324-144652346 CCTTGGTGGGATTCATCAGATGG + Intergenic
963601992 3:147386837-147386859 CCTTTCTGCCGTTAATAAGAAGG - Exonic
963761398 3:149289870-149289892 CCTTGCAGCCTTTCCTGAGATGG - Intergenic
968113468 3:196069799-196069821 CCATGCTGCCTTTCATCTGAAGG + Intronic
968286941 3:197514271-197514293 CCTTTCTCCCCCTCATCCGAAGG - Exonic
968654528 4:1772798-1772820 CCTTCCTGCCTTCCATCAGGGGG - Intergenic
978184188 4:105837443-105837465 CCATGTGGCCCTTCATCACATGG + Intronic
978190891 4:105910274-105910296 CCTTGCTTCAGTTCATCTGAAGG - Intronic
982371696 4:154640325-154640347 TGCTGCTGCCCTTCATAAGATGG + Intronic
993415830 5:87628982-87629004 TCTGGCTGTCCTTCCTCAGATGG - Intergenic
995943542 5:117613664-117613686 GCATGCTGACCCTCATCAGATGG - Intergenic
996318544 5:122188531-122188553 CCTTGCTGGCTTTCAGCTGAGGG - Intergenic
997823589 5:137087183-137087205 CCCTGCTGCAGTTCATCAGATGG - Intronic
998071441 5:139200911-139200933 CCTTGCTGCCTTGCTTCACATGG - Intronic
998399573 5:141841593-141841615 CCCTGCTGCCCTGCATCTGCTGG + Intergenic
1002588700 5:180271748-180271770 TCTTGCTGCCACTCATAAGAGGG + Intronic
1004389536 6:15198497-15198519 CTTTGCTGCCCTGAATCACAAGG + Intergenic
1006912864 6:37575399-37575421 CCTTGCTTCCGTTCAGGAGAAGG + Intergenic
1007494994 6:42253709-42253731 CCTTCCTGCCTGTCATCACAAGG - Intronic
1013386403 6:109636035-109636057 CCTTGCTGCCCTTTATTCAATGG - Intronic
1015999684 6:139029601-139029623 CCCTGCAGCCCATCATCACACGG - Intronic
1017260381 6:152378791-152378813 CCTTGCAGACATTCATCACAAGG + Intronic
1017721700 6:157247548-157247570 CCTTGCTACCCTCAACCAGAAGG - Intergenic
1018587814 6:165382260-165382282 CCTTCCAGCCCTTAATCATAAGG + Intronic
1028851209 7:95539948-95539970 GCTTGCTGCCCTGCATCTTAAGG + Exonic
1029477193 7:100792104-100792126 CTTTGCTGCCTGTCACCAGACGG + Exonic
1032087294 7:128890904-128890926 CCTTGCTGCCCCTCCTGCGACGG - Exonic
1032267888 7:130381336-130381358 CCTTGCTGCCCTTGAGCACCTGG + Intronic
1039905243 8:41781696-41781718 CCTCCCTGCCCTTCATGGGAAGG + Intronic
1039976423 8:42370160-42370182 CCTTGATGGCCTTCAACTGAGGG - Intronic
1041461313 8:58114907-58114929 CCTTGCTGCCCTTCATCAGAGGG - Intronic
1042057164 8:64776746-64776768 CCTAGCTGCCCTTCCTCTAAAGG + Intronic
1042965706 8:74350157-74350179 CCTTACTGCCCTTCATAACCAGG + Intronic
1043085009 8:75819129-75819151 CCTTGCTGGCTGTCAGCAGATGG + Intergenic
1044739296 8:95309349-95309371 GCTTGCTGCTGTTGATCAGAGGG + Intergenic
1047524127 8:125617964-125617986 CCTTCCTGCCCATGGTCAGAGGG + Intergenic
1049105266 8:140608792-140608814 CCTTGCTGCCCTGGAGCAGCTGG - Intronic
1049146543 8:141005033-141005055 CCTTCCTGCACTGCACCAGATGG + Intergenic
1049386640 8:142346056-142346078 CCTTGCTGGCATTCAGCAGAAGG - Intronic
1051478783 9:17537656-17537678 CCTTGCTGCCCTCCATGTGCAGG - Intergenic
1053000168 9:34573590-34573612 GCCGGATGCCCTTCATCAGATGG - Intronic
1054858228 9:69923922-69923944 CCTTGCTGCAGTTCATGAGTTGG + Intergenic
1056949707 9:91032322-91032344 CTGTGCTTCCCTTCAGCAGAAGG - Intergenic
1057694504 9:97313689-97313711 CCATTCTGCCCTTCATCAGAAGG - Intronic
1057750002 9:97784963-97784985 CCTTGTTGCCTCACATCAGAAGG - Intergenic
1058004382 9:99900314-99900336 CCTTCCTACCCTTGACCAGAGGG - Intergenic
1058345902 9:103961888-103961910 TTTTTCTGCCCTTAATCAGAGGG - Intergenic
1060039038 9:120283901-120283923 TCTTCCTGCCCTCCATCAGAAGG - Intergenic
1060130955 9:121098939-121098961 CCTTACTGCCATTCTTCACATGG - Intronic
1061434001 9:130549159-130549181 CCTGGCTGCTTTTCATCAAAAGG + Intergenic
1061572516 9:131486485-131486507 CCTTTCTTCTCTTCATCAGAAGG - Intronic
1062441643 9:136572361-136572383 CTATGCTGCCCTTCCCCAGAGGG - Intergenic
1062521601 9:136960155-136960177 CCGTGCAGACCTTCATCTGAGGG + Intergenic
1187424282 X:19162984-19163006 CCCAGCTGGCCTTCATGAGAGGG - Intergenic
1187933778 X:24316546-24316568 CCCTGCTGCCGTTAATTAGAGGG + Intergenic
1192753125 X:74015675-74015697 CGTAGCTGCCCTTCTTCACAGGG - Intergenic
1193423834 X:81316588-81316610 CATTTCTGCCCTGCCTCAGAAGG - Intergenic
1195868235 X:109456801-109456823 CCATGGTGCCCTTCAGCAAAGGG + Intronic
1197651858 X:129073858-129073880 CCCTGCTGGTCATCATCAGAGGG - Intergenic
1197839804 X:130734123-130734145 CCTTGCTTTCCTGCACCAGAGGG - Intronic
1199038940 X:143087177-143087199 CCTTGCTTTCCTGCATCAGCTGG - Intergenic