ID: 1041461694

View in Genome Browser
Species Human (GRCh38)
Location 8:58118632-58118654
Sequence CTTTGTAACTAAAAGTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041461694_1041461697 30 Left 1041461694 8:58118632-58118654 CCTTCACACTTTTAGTTACAAAG 0: 1
1: 0
2: 0
3: 12
4: 200
Right 1041461697 8:58118685-58118707 AGCATCTTCCAGGCCACTTATGG No data
1041461694_1041461696 20 Left 1041461694 8:58118632-58118654 CCTTCACACTTTTAGTTACAAAG 0: 1
1: 0
2: 0
3: 12
4: 200
Right 1041461696 8:58118675-58118697 ATCAGTTGTGAGCATCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041461694 Original CRISPR CTTTGTAACTAAAAGTGTGA AGG (reversed) Intronic
906265022 1:44422079-44422101 CTTTGTGACTATATGTGGGAAGG - Intronic
906506288 1:46382280-46382302 CTTTTTTACTTAAAGTATGATGG - Intergenic
909613504 1:77579416-77579438 CTCTGTAGCTGAAAGTGTTATGG + Intronic
910369003 1:86496457-86496479 GTTTGTAACCAAAAGTGGTATGG - Intronic
912892239 1:113546661-113546683 AGTTGTAAAGAAAAGTGTGAGGG - Intronic
912902868 1:113671680-113671702 ATTTGTACATAAAAATGTGAAGG - Intronic
916205674 1:162314157-162314179 TTTTGTATCTAAAACTGGGAAGG + Intronic
916432432 1:164744004-164744026 CTAGGTAACTAGAAGTCTGATGG + Intronic
920876280 1:209839147-209839169 CTTTGAGACCTAAAGTGTGAAGG + Intronic
922365594 1:224860530-224860552 CTTTGTTAGTATAAGTGTGATGG - Intergenic
922772838 1:228197353-228197375 CTTGGTATCTAAATGTGTGAGGG + Intergenic
923763000 1:236864182-236864204 CTTTGTAATGAAAAGCCTGATGG + Intronic
1068207648 10:53876893-53876915 CTTTGTAATTCAAACTATGATGG - Intronic
1068807993 10:61221909-61221931 CTTTGTCACTGAAAGACTGAAGG - Intergenic
1070690979 10:78525178-78525200 TTTTGTAAATAAAAGTGTATTGG + Intergenic
1071785779 10:88898133-88898155 CTTAGTAATTAAGAGTGTAAAGG - Intronic
1073905695 10:108276730-108276752 CTTTATAACTAGAAGTGGGGTGG + Intergenic
1074672067 10:115802377-115802399 CTTTTCAAATAAAAGTATGATGG - Intronic
1081564198 11:44247131-44247153 GTTTATACCTAAATGTGTGAGGG - Intergenic
1089073993 11:115722424-115722446 CTTTGTCACTCAAAGTGTGTAGG - Intergenic
1092607974 12:10140766-10140788 CTTTGTAAAAATAAGAGTGAAGG + Intergenic
1094767104 12:33609435-33609457 CTTTGTTACTAAAGATTTGAAGG - Intergenic
1095379416 12:41572210-41572232 CTTTATTTCTAAAATTGTGATGG + Intronic
1099282902 12:80675419-80675441 GTTTTTAACTAAAAATGAGAAGG - Intronic
1099988080 12:89692103-89692125 CTTTGAAACTTAAAGTGTATAGG - Intronic
1100136716 12:91561910-91561932 CATTGAAACTAAATGAGTGAAGG - Intergenic
1102289593 12:111688296-111688318 ATTTGAAACTAAAAATGTCAAGG - Intronic
1104723874 12:131063408-131063430 GTTTTTATCTAAAAGTGTTATGG + Intronic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1106879244 13:34111415-34111437 CTTTGTAATTAAAAATATTATGG + Intergenic
1108537082 13:51394237-51394259 CTTTGTTAATTAAATTGTGAAGG + Intronic
1110488452 13:76073502-76073524 TTCTGTGACTAAATGTGTGAGGG - Intergenic
1111901090 13:94200581-94200603 CTATTCAAATAAAAGTGTGATGG + Intronic
1112527015 13:100159590-100159612 CTTTGTAAATGAAAGTAAGAAGG + Intronic
1113016251 13:105831603-105831625 TTATGTAACTAAAAGGGAGAGGG - Intergenic
1113334294 13:109363521-109363543 TTTTGTAACTAAAGGTATGTGGG - Intergenic
1115910579 14:38253212-38253234 CTTTAAAACTAAGAGTGTGGGGG - Intergenic
1117779648 14:59219276-59219298 CTTTGTAGGTAAAATTGTGTGGG + Intronic
1119052010 14:71378122-71378144 CACTCTAACTAAAAGTGTGTCGG + Intronic
1119531062 14:75361739-75361761 GTTTGTACCTATAAGTATGAAGG - Intergenic
1120175680 14:81290813-81290835 CTTGGTAACTAAAAGAGAGTTGG - Intronic
1122587724 14:102821260-102821282 CGGTGTTACTAAAAGTGTCACGG - Intronic
1123832888 15:24159836-24159858 CTTGGTAATAAAGAGTGTGATGG - Intergenic
1123839611 15:24234739-24234761 CTTGGTAATAAAGAGTGTGATGG - Intergenic
1123849479 15:24340535-24340557 CTTGGTAATAAAGAGTGTGATGG - Intergenic
1123852676 15:24376498-24376520 CTTGGTAATAAAGAGTGTGATGG - Intergenic
1123868534 15:24548053-24548075 CTTGGTAATAAAGAGTGTGATGG - Intergenic
1124322063 15:28721465-28721487 CTTTCTAAGTAAAAGTTTAATGG + Intronic
1124523163 15:30423307-30423329 CTTTCTAAGTAAAAGTTTAATGG + Intergenic
1124535503 15:30542909-30542931 CTTTCTAAGTAAAAGTTTAATGG - Intergenic
1124763151 15:32464687-32464709 CTTTCTAAGTAAAAGTTTAATGG + Intergenic
1124775476 15:32584372-32584394 CTTTCTAAGTAAAAGTTTAATGG - Intergenic
1124811887 15:32948107-32948129 TTTTGTAACTAAGATTGTAAGGG - Intronic
1129916514 15:79278340-79278362 CTGCATAACTAAAAGTCTGAAGG - Intergenic
1130006614 15:80105274-80105296 GTTTTTTATTAAAAGTGTGATGG - Intronic
1131569113 15:93515557-93515579 CTTTGTAGCTTAAAGTGTGCTGG + Intergenic
1134899461 16:17923648-17923670 CTTTTTTCCTAAAAGTGTTATGG - Intergenic
1140191129 16:72817865-72817887 CTTTTTAGCTAAGAGTCTGATGG - Intronic
1140893425 16:79304784-79304806 TTTTGTGACCAAAAGTGTAATGG - Intergenic
1144003606 17:11078681-11078703 CTTTGAAAGTAAGTGTGTGATGG + Intergenic
1151009465 17:70476808-70476830 CTTTTTAATAAGAAGTGTGATGG - Intergenic
1152138257 17:78519801-78519823 ATTTGTAACTAAAAATCTCATGG + Intronic
1152787573 17:82257501-82257523 CTTAGTTACTTAAGGTGTGAGGG - Intronic
1154977964 18:21477417-21477439 CCTTGTAACAAAATGTGTCATGG + Intronic
1155924926 18:31645630-31645652 CATTGAAACTAAAAGTGAAAGGG - Intronic
1156557865 18:38087883-38087905 CTTTGTAACTGCATTTGTGAAGG + Intergenic
1159518299 18:69486790-69486812 CTTTTTAACTAACAATGTTAAGG + Intronic
1159524082 18:69565991-69566013 GTTTGTAAGTAAAATTTTGATGG + Intronic
1162260855 19:9532683-9532705 CTCTGTAAATAAAAGCGTGTGGG + Intronic
1162598464 19:11647967-11647989 CTTTCTAAATAAACGTGTGTAGG + Intergenic
1164997692 19:32734672-32734694 GTTTGTACTTAAAAGTGTAAAGG - Intronic
928673143 2:33622568-33622590 CTATGTGACTAACAGTGAGATGG + Intergenic
928816007 2:35295333-35295355 CTTTATTATTAAAAGAGTGATGG - Intergenic
929086835 2:38176414-38176436 CTGTCTAACTAAAATTATGAAGG + Intergenic
930394716 2:50806695-50806717 CCTTGTACCTAAAAGTTTGATGG + Intronic
931780512 2:65575566-65575588 CTTTGTAAGTAAAAATGAAAGGG + Intergenic
937651470 2:124324157-124324179 CCTAGGAACTAAAGGTGTGATGG - Intronic
938721722 2:134073226-134073248 TTTCTTAACTAAAAGAGTGAAGG + Intergenic
939394998 2:141617325-141617347 CTATGTAAGTCAAAGTGTTATGG + Intronic
940214524 2:151290564-151290586 CTTTGTATCAAAAAGGTTGATGG + Intergenic
940539394 2:154991589-154991611 CTTTGTGTCTAAAAGTGTTTAGG + Intergenic
940841013 2:158581651-158581673 CTTTGATCCTACAAGTGTGAGGG - Intronic
942700951 2:178709933-178709955 ATTTTTAACTAAAAATATGAGGG - Intronic
942727825 2:179028870-179028892 CTTTATAACTATATGTGGGATGG - Intronic
942887628 2:180946893-180946915 TTTTGTAACTAAATTTTTGATGG + Intergenic
943722254 2:191217419-191217441 CTTTTTAACTAAAAATTTTAAGG + Intergenic
946096089 2:217275075-217275097 CATTGAAAATGAAAGTGTGATGG - Intergenic
947792982 2:232878292-232878314 CTGGGTAACTGAAGGTGTGAAGG + Intronic
1169221713 20:3827011-3827033 ATTTAGAACTAAAAGTGAGATGG + Exonic
1170588289 20:17752015-17752037 CATTGTAACTAAAAGGCTGGTGG + Intergenic
1170744148 20:19083706-19083728 TTTTGTACCTAGAAGTGAGATGG + Intergenic
1172077470 20:32310320-32310342 CTTTGTCACCAAGAGTGTGAAGG + Exonic
1173379209 20:42523139-42523161 AATTGTAGCTAAAACTGTGAAGG - Intronic
1174764173 20:53236217-53236239 CTTTGTAAATAAAGAAGTGATGG - Intronic
1175453435 20:59090568-59090590 CTATGTATCTAAGAGTGTAATGG + Intergenic
1177026768 21:15930716-15930738 CTATTTAACTTAAAGTTTGATGG + Intergenic
1177093659 21:16802710-16802732 CTTTGTGACTTAAAATGAGAAGG - Intergenic
1177242475 21:18477413-18477435 CTTTCTATCTATAAATGTGATGG - Intronic
1177520962 21:22224966-22224988 TTTTTTAACTAAAATTTTGAGGG - Intergenic
1177914762 21:27075101-27075123 CTTTGTAATTGAATCTGTGATGG - Intergenic
1178164334 21:29955117-29955139 TTTTGTAAGTAAAGCTGTGAAGG + Intergenic
1178288834 21:31349281-31349303 GTTTGTAACTGAAAGGGTGAAGG + Intronic
1180242668 21:46521649-46521671 CTCTTTAACAAAAAGTGTAAAGG - Intronic
1184088551 22:42280499-42280521 CCTAGAAACTAAAAGTGTGCAGG - Intronic
949112580 3:280249-280271 TTTTGTATCTAAAAGAATGAGGG + Intronic
952388537 3:32860455-32860477 CTTTTTAAAGAAAGGTGTGAGGG - Intronic
956097915 3:65736896-65736918 CTTTGAAATTAATAGTGAGATGG - Intronic
956624268 3:71251386-71251408 CACTGTAACTCAAGGTGTGATGG + Intronic
958259086 3:91358655-91358677 CTTTGTAAATAAAATTGTATTGG - Intergenic
958960142 3:100502145-100502167 TTTTTTAATTTAAAGTGTGAGGG - Intronic
959414758 3:106070811-106070833 CTTTATTAAGAAAAGTGTGATGG - Intergenic
960032833 3:113072076-113072098 CTTTGGAACCAAGAGTGTGCTGG - Intergenic
960127752 3:114018955-114018977 ATTTGTTTTTAAAAGTGTGAGGG - Intronic
960508890 3:118525113-118525135 TTTTGTAACTAAATGTGTATTGG - Intergenic
962616803 3:137134785-137134807 CTTTGGAACATAAACTGTGATGG + Intergenic
964511188 3:157453761-157453783 CTTTGCAACTTAAAGTTTGATGG + Intronic
964710742 3:159668825-159668847 CTTTTCAAATAAAAGTGTTATGG + Intronic
965983711 3:174725363-174725385 CTAGGTAAATAAAAGTGGGATGG - Intronic
967252761 3:187559929-187559951 ATTTGTAACTCAGTGTGTGAGGG - Intergenic
967428962 3:189359910-189359932 CTTTGTACCCAATAGTGTTATGG - Intergenic
969522858 4:7688919-7688941 CTCTGTATCTCAAAGTGAGAGGG + Intronic
970396158 4:15668138-15668160 ATTTGTGACTTAATGTGTGAAGG + Intronic
975738103 4:77401422-77401444 CTTTGTTTCCAAAAGTATGATGG + Intronic
975999331 4:80354567-80354589 CTATATAGCTAAAAGTGTCATGG + Intronic
976674168 4:87685871-87685893 CTTTGAAGATAAAAGTGTTATGG - Intergenic
977380074 4:96261821-96261843 CTTTGTAAGATAAAGTGTGCAGG - Intergenic
977475387 4:97500818-97500840 CTATGTAACGTAAAGAGTGAAGG + Intronic
977878761 4:102180011-102180033 CTTTTTAAATCTAAGTGTGAGGG - Intergenic
978434252 4:108666406-108666428 CTTTGTAACTTTAAGAGGGAAGG + Intronic
978789703 4:112648330-112648352 TTTTGTAACAAAAGGTGTGCTGG + Intronic
979384951 4:120053926-120053948 TTTTGTAACCAAAGGTGTGTTGG - Intergenic
979924122 4:126538422-126538444 CTTTATAAATCACAGTGTGATGG - Intergenic
980731916 4:136834890-136834912 CATTGTAACTAATATTGTGGAGG + Intergenic
980795938 4:137682911-137682933 CTTTATAACAAAAAATGTGGAGG + Intergenic
981320435 4:143385837-143385859 GTTTGTAAATAAAAGTGTATTGG + Intronic
981358526 4:143820940-143820962 CCTTGTACCTAAAAGTCTGATGG - Intergenic
981505201 4:145492155-145492177 TTTTGTGACTAAATGTGTGTGGG + Intronic
982273236 4:153613641-153613663 ATTTTTAACTAAAAATGTAAGGG - Intronic
982473265 4:155819540-155819562 CTTTGTATTTAACTGTGTGAAGG + Intergenic
982605304 4:157508589-157508611 CTTTGAAACTAAAAATATAAGGG - Intergenic
983605221 4:169575344-169575366 CTTTGTCAGTAAAACTGAGAGGG + Intronic
984517493 4:180758289-180758311 CTTTGTGACCAAATATGTGAGGG - Intergenic
986933742 5:12857774-12857796 CTGTGTAACAAAAAGAGAGAGGG - Intergenic
987674215 5:21053022-21053044 CTTTGTAACAGAAATTGTGCTGG + Intergenic
989507187 5:42240132-42240154 CTTTGTAACTAAAATTTTTTAGG - Intergenic
993595638 5:89851737-89851759 CTTTGTAACTAATAGGATGTGGG + Intergenic
995446946 5:112255009-112255031 CTCTGAACCTAAAAGTGGGAAGG + Intronic
996217282 5:120885326-120885348 TTTAGTAAATAAATGTGTGAAGG - Intergenic
996801719 5:127410756-127410778 CATTTTAACTTAATGTGTGATGG + Intronic
996989072 5:129606072-129606094 CTTTGGAACTAAAAGGCTAATGG + Intronic
998037778 5:138931321-138931343 TTTTGTACCTATCAGTGTGAGGG - Intronic
998236720 5:140403993-140404015 CTTTGGAAAAAAAAGTGTGTGGG + Intronic
999823422 5:155251142-155251164 CTTTTAAACTAAAATAGTGAAGG - Intergenic
999982942 5:156975399-156975421 GCATGTAACTAAAAGTGTCATGG + Intergenic
1001821152 5:174711296-174711318 CTTTAAAAATAAAAGTGTGGCGG + Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003876180 6:10439407-10439429 CTTTTTAACTAAAAGTTTATTGG + Intergenic
1006656792 6:35601896-35601918 CTATGTAACTTAAAGGGGGAGGG + Intronic
1007335527 6:41152431-41152453 TTTAGTAACTCAAAGTGTCAAGG + Intronic
1007786881 6:44285655-44285677 CTCTGTAGCTAACAGTCTGATGG - Intronic
1008996173 6:57661936-57661958 CTTTGTAAATAAAATTGTATTGG + Intergenic
1009184700 6:60560715-60560737 CTTTGTAAATAAAATTGTATTGG + Intergenic
1009236144 6:61125856-61125878 GTTTGTAATTAAATGTGTCATGG + Intergenic
1009511616 6:64557667-64557689 CTTTATTACTAAAAGTTTAACGG + Intronic
1010209217 6:73349668-73349690 TTTTGGAAGTAAAAGTCTGAAGG - Intergenic
1012202032 6:96418622-96418644 CTTAGTGACTGAAACTGTGATGG - Intergenic
1013413521 6:109903803-109903825 CTATGTGACTAAAAGTGTACTGG - Intergenic
1014277047 6:119399203-119399225 CTTTGTATCACATAGTGTGAGGG - Intergenic
1014486590 6:122006762-122006784 CAATGTAACTAAAACTGTAAAGG - Intergenic
1014712854 6:124828762-124828784 CTTTGTAACTTAAACTGACAAGG - Intergenic
1016166406 6:140950300-140950322 CTTTCTATCTAAGAATGTGAGGG + Intergenic
1021236634 7:18150310-18150332 CTGTGTAATTTAAAGAGTGATGG + Intronic
1026383473 7:69822249-69822271 CTGTGTTGCTAAAATTGTGATGG - Intronic
1027564589 7:79776049-79776071 TTTTGTGACCAAATGTGTGAGGG + Intergenic
1027704683 7:81514408-81514430 CTTTTTAAATAAATGTGTTATGG + Intergenic
1027853244 7:83475765-83475787 CTTTGTGACAAAAACTGTGAAGG - Intronic
1030648661 7:112092952-112092974 CCTAGTAACTGAAAGTGTCATGG + Intronic
1032634669 7:133693552-133693574 CTGTGTAATTAGGAGTGTGATGG - Intronic
1032825160 7:135561582-135561604 CTCTGTGACTAGAAGTCTGAGGG - Intronic
1033531355 7:142267181-142267203 CTTTATAACTAAACGTGAAAAGG - Intergenic
1039320349 8:36423528-36423550 GATTGTAACTAAAATTGTGGAGG - Intergenic
1040857112 8:51959910-51959932 CTGTGTAACTTACAGTGTGGTGG + Intergenic
1041447906 8:57973641-57973663 TTTTGTAGCTTACAGTGTGAAGG + Intergenic
1041461694 8:58118632-58118654 CTTTGTAACTAAAAGTGTGAAGG - Intronic
1041618588 8:59937321-59937343 CTTTGTAATAAAAAGTAAGAAGG - Intergenic
1041783670 8:61607321-61607343 CTCTGTAAATGAAAGTGTGTCGG + Intronic
1043183474 8:77114975-77114997 CTATTTGATTAAAAGTGTGAAGG - Intergenic
1043367440 8:79551079-79551101 CTTTGTTATTAAAAGTTTAAAGG - Intergenic
1044565242 8:93655346-93655368 CTTTGAAACTGTGAGTGTGAGGG + Intergenic
1046446899 8:114333460-114333482 CTTTGTTAATAATATTGTGAAGG + Intergenic
1047906851 8:129481623-129481645 CTTTGGAACCAAAAGTGGAAAGG - Intergenic
1047915123 8:129574863-129574885 CTATGTAAGTTAAAGGGTGAGGG - Intergenic
1048813052 8:138306046-138306068 TTTTCTTAGTAAAAGTGTGATGG - Intronic
1051239857 9:15042669-15042691 ATTTGTATGTAAAACTGTGATGG + Intergenic
1052247795 9:26358875-26358897 CTTTGTAATAAAAAATATGATGG - Intergenic
1053090257 9:35268783-35268805 CTTTGTAACTAAGTGTGTAGTGG + Intronic
1054962184 9:70981137-70981159 CTTTGTCACTAGAAGTGAGCAGG - Intronic
1055364853 9:75532211-75532233 CTTTGTGAATTATAGTGTGAAGG - Intergenic
1056288011 9:85110908-85110930 GATAGTAACTGAAAGTGTGATGG + Intergenic
1057757561 9:97850013-97850035 CTTTGTAAATAAAAACGAGAGGG - Intergenic
1059387038 9:113972703-113972725 CTATGTAAGTAATAGTGTGTTGG - Intronic
1061563065 9:131419047-131419069 TTTTGTTACTAAAAATGTGATGG + Intronic
1188255654 X:27959705-27959727 CTTTTGGACTAAAAGAGTGATGG - Intergenic
1191154849 X:57262598-57262620 CTTTCTAACTAATTGTATGAAGG + Intergenic
1191614954 X:63160611-63160633 TTTTGTAAATAAAATTGTGTTGG - Intergenic
1191621342 X:63218312-63218334 TTTTGTAAATAAAATTGTGTTGG + Intergenic
1191628616 X:63296882-63296904 TTTGGAAATTAAAAGTGTGAGGG + Intergenic
1191681824 X:63848365-63848387 CTCTGTAACTAAAAGGGTTATGG + Intergenic
1194875616 X:99184181-99184203 CTTTGAAACTAATAATGTAAAGG + Intergenic
1196963309 X:121027069-121027091 CTTTGTAACTGTGAGGGTGAGGG + Intergenic
1198055154 X:132986816-132986838 CTGTGAAACTAAAAGTGAGGTGG + Intergenic
1198327502 X:135588015-135588037 AATTGTAACCAAAAGTGAGATGG + Intergenic
1199289057 X:146085929-146085951 TTTTGTAAATAAAATTGTGTTGG - Intergenic