ID: 1041462058

View in Genome Browser
Species Human (GRCh38)
Location 8:58121911-58121933
Sequence CCATCCAGAAGGGCAGCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041462058_1041462062 -5 Left 1041462058 8:58121911-58121933 CCTTTGGCTGCCCTTCTGGATGG No data
Right 1041462062 8:58121929-58121951 GATGGAATCCCCTCTTTTCTTGG No data
1041462058_1041462066 19 Left 1041462058 8:58121911-58121933 CCTTTGGCTGCCCTTCTGGATGG No data
Right 1041462066 8:58121953-58121975 TCTCATATCTCTTTCTTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041462058 Original CRISPR CCATCCAGAAGGGCAGCCAA AGG (reversed) Intronic