ID: 1041465612

View in Genome Browser
Species Human (GRCh38)
Location 8:58155097-58155119
Sequence GGCCACTGTGATCTGTCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041465609_1041465612 -3 Left 1041465609 8:58155077-58155099 CCAATATCCCAATGCATTCTGGC 0: 1
1: 0
2: 0
3: 11
4: 99
Right 1041465612 8:58155097-58155119 GGCCACTGTGATCTGTCATGAGG No data
1041465610_1041465612 -10 Left 1041465610 8:58155084-58155106 CCCAATGCATTCTGGCCACTGTG 0: 1
1: 0
2: 1
3: 21
4: 244
Right 1041465612 8:58155097-58155119 GGCCACTGTGATCTGTCATGAGG No data
1041465607_1041465612 10 Left 1041465607 8:58155064-58155086 CCTCTGTTGATTTCCAATATCCC 0: 1
1: 0
2: 0
3: 16
4: 135
Right 1041465612 8:58155097-58155119 GGCCACTGTGATCTGTCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041465612 Original CRISPR GGCCACTGTGATCTGTCATG AGG Intronic
No off target data available for this crispr