ID: 1041468368

View in Genome Browser
Species Human (GRCh38)
Location 8:58180651-58180673
Sequence CTGAGGCCACAGATAGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 271}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041468368_1041468381 7 Left 1041468368 8:58180651-58180673 CCTAGCTCTATCTGTGGCCTCAG 0: 1
1: 0
2: 1
3: 17
4: 271
Right 1041468381 8:58180681-58180703 GGGAGGGGAGGAGAAACCTGGGG No data
1041468368_1041468378 -5 Left 1041468368 8:58180651-58180673 CCTAGCTCTATCTGTGGCCTCAG 0: 1
1: 0
2: 1
3: 17
4: 271
Right 1041468378 8:58180669-58180691 CTCAGGGATATGGGGAGGGGAGG No data
1041468368_1041468379 5 Left 1041468368 8:58180651-58180673 CCTAGCTCTATCTGTGGCCTCAG 0: 1
1: 0
2: 1
3: 17
4: 271
Right 1041468379 8:58180679-58180701 TGGGGAGGGGAGGAGAAACCTGG No data
1041468368_1041468376 -8 Left 1041468368 8:58180651-58180673 CCTAGCTCTATCTGTGGCCTCAG 0: 1
1: 0
2: 1
3: 17
4: 271
Right 1041468376 8:58180666-58180688 GGCCTCAGGGATATGGGGAGGGG No data
1041468368_1041468374 -10 Left 1041468368 8:58180651-58180673 CCTAGCTCTATCTGTGGCCTCAG 0: 1
1: 0
2: 1
3: 17
4: 271
Right 1041468374 8:58180664-58180686 GTGGCCTCAGGGATATGGGGAGG No data
1041468368_1041468380 6 Left 1041468368 8:58180651-58180673 CCTAGCTCTATCTGTGGCCTCAG 0: 1
1: 0
2: 1
3: 17
4: 271
Right 1041468380 8:58180680-58180702 GGGGAGGGGAGGAGAAACCTGGG No data
1041468368_1041468375 -9 Left 1041468368 8:58180651-58180673 CCTAGCTCTATCTGTGGCCTCAG 0: 1
1: 0
2: 1
3: 17
4: 271
Right 1041468375 8:58180665-58180687 TGGCCTCAGGGATATGGGGAGGG No data
1041468368_1041468382 17 Left 1041468368 8:58180651-58180673 CCTAGCTCTATCTGTGGCCTCAG 0: 1
1: 0
2: 1
3: 17
4: 271
Right 1041468382 8:58180691-58180713 GAGAAACCTGGGGCTCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041468368 Original CRISPR CTGAGGCCACAGATAGAGCT AGG (reversed) Intronic
900478678 1:2887944-2887966 CTGAGACCTCAGTGAGAGCTGGG - Intergenic
900709805 1:4106625-4106647 CTGATGCCCCACATACAGCTGGG + Intergenic
901916473 1:12504286-12504308 GTGAGGCCACAGCTGGAACTGGG - Intronic
902289551 1:15427375-15427397 CTGAGGCTGCAGACAGAGATGGG + Intronic
902989852 1:20179147-20179169 CTGAGGCCACAGGGAGCTCTGGG - Intergenic
903211799 1:21822988-21823010 TGGAGCCCCCAGATAGAGCTGGG - Exonic
903274729 1:22213125-22213147 CTGGGGCCAGGGACAGAGCTGGG - Intergenic
906077683 1:43064018-43064040 CTTAGGCCACCTACAGAGCTGGG + Intergenic
906132539 1:43469163-43469185 CTGGGTCCACAGCTATAGCTTGG + Intergenic
906257123 1:44358884-44358906 CTAAGGTCACAGATGGAGCCAGG - Intergenic
908113964 1:60923417-60923439 CTGAGCCCACAGACAAAGCCAGG + Intronic
910022846 1:82613568-82613590 CTGAGTCCAGGGAAAGAGCTGGG + Intergenic
911288768 1:96029177-96029199 CTGAGTCCACAGCCACAGCTGGG + Intergenic
912755140 1:112318184-112318206 CCGAGGCCACAGAAAGAGGATGG - Intergenic
913453517 1:119008260-119008282 CTGTGGCCGCAGCTAGACCTAGG + Intergenic
915065503 1:153221118-153221140 CAGAGGCCACAGGGACAGCTAGG + Intergenic
916338330 1:163698441-163698463 CAGAGCACACAGAAAGAGCTTGG - Intergenic
916378906 1:164187319-164187341 TTAAGTCCACAGAGAGAGCTTGG - Intergenic
916445245 1:164865962-164865984 CTGAGGCTACAGAAAGTGCAGGG - Intronic
917769694 1:178264217-178264239 CTGAGGCAACGGGTAGAGATAGG - Intronic
919584862 1:199424153-199424175 CTGAGTTCACAGAAAGAGTTAGG - Intergenic
919862323 1:201748475-201748497 CTGAGGCCAGGGGTAGAGCTTGG - Intronic
920190787 1:204192426-204192448 CTGAGGTCACCGATAAAGCAAGG + Intronic
922219290 1:223545496-223545518 CTGAGGCCAGGCACAGAGCTAGG + Intronic
922224840 1:223637282-223637304 GTGTGGCTACAGATAGTGCTAGG - Intronic
922856996 1:228783881-228783903 CTGAGGCCACATGTGGAGCCTGG - Intergenic
923946090 1:238889195-238889217 GTGAGGACACTGATAGAGCAGGG - Intergenic
924256660 1:242189933-242189955 CTGAGGTCAAAGAGACAGCTCGG + Intronic
1062860029 10:803696-803718 CAGAGGGCACAGAGTGAGCTGGG - Intergenic
1063309740 10:4940991-4941013 CTGAGGCTACAGAGAGAACAGGG + Intronic
1064828557 10:19434737-19434759 CTGAGGCAAAAGATAAATCTGGG + Intronic
1065324856 10:24541670-24541692 CTGAGGCTACTGATACACCTTGG + Intronic
1065474439 10:26118932-26118954 CTGGGCCAACAGAAAGAGCTTGG - Intronic
1068937397 10:62649248-62649270 GTGAGGGCAAAGATTGAGCTGGG - Intronic
1069986211 10:72286038-72286060 ATGGGGCAACAGAGAGAGCTTGG + Intergenic
1070833558 10:79434500-79434522 CTGGGGTCACAGTAAGAGCTTGG - Intronic
1071426841 10:85565704-85565726 CTGAGAGCAGAGAAAGAGCTGGG + Intergenic
1071983848 10:91031318-91031340 CAGAGGCCACAGAAGCAGCTGGG - Intergenic
1073423615 10:103443052-103443074 CTGAGGACACAGATAGAGGCTGG + Intronic
1074708767 10:116159512-116159534 CTGATGCCACACACAGAGCTTGG + Intronic
1075177549 10:120179760-120179782 GTGAGTCCACAGAAAGAGCAAGG + Intergenic
1075647283 10:124104808-124104830 CTCAGACCAGAGGTAGAGCTTGG - Intergenic
1076063868 10:127433357-127433379 CAGAGGCCACAGACAGAGGGCGG - Exonic
1077162016 11:1118089-1118111 CTGAGGGCACGGCCAGAGCTGGG + Intergenic
1077169654 11:1160533-1160555 CTGCGGCCACAGATGCAGCATGG - Intronic
1077299005 11:1838689-1838711 CTGAGGCCACAGGCAAAGCCAGG + Intergenic
1077341250 11:2027354-2027376 GTGTGGCCACAGAGACAGCTAGG + Intergenic
1078105028 11:8353064-8353086 CTGATGCCACAGGTAGATCTAGG - Intergenic
1079239006 11:18709364-18709386 GTGAGGACACAGAGAGGGCTGGG - Intronic
1080297937 11:30751697-30751719 CTGTGGTCACATATGGAGCTAGG - Intergenic
1083945563 11:65920891-65920913 CTGAGGACACAGATACTGATGGG + Exonic
1084615238 11:70231482-70231504 CTGATGCCACGGACAGCGCTTGG - Intergenic
1084749434 11:71194405-71194427 TTGAGGCCACAGAGAGAGTGAGG - Intronic
1085033416 11:73286243-73286265 CTCAGGCCCCAGGAAGAGCTAGG + Intronic
1088920979 11:114259575-114259597 CTGAAACCACACAGAGAGCTGGG - Intronic
1090588020 11:128235143-128235165 ATGAGGAAACAGATAAAGCTGGG + Intergenic
1090876604 11:130794488-130794510 CCTAGGGCACACATAGAGCTGGG + Intergenic
1091038185 11:132252560-132252582 CTGAGGCCAGAGATGTAGATGGG + Intronic
1091184509 11:133635814-133635836 CTGACCCCCCAGATAGAGCAAGG + Intergenic
1202824235 11_KI270721v1_random:82543-82565 GTGTGGCCACAGAGACAGCTAGG + Intergenic
1091714904 12:2770149-2770171 ATGAGGCCACAGATTGAGCCAGG - Intergenic
1091799809 12:3317694-3317716 CTGAGGCCCCAGAGCAAGCTGGG + Intergenic
1092070439 12:5627298-5627320 CTGAGGCCACCCAGAGAGCCGGG + Intronic
1095734064 12:45537033-45537055 CTGGGTACACAGATAGTGCTCGG - Intergenic
1096264062 12:50110105-50110127 CTGAGGACACAGATGTTGCTAGG - Exonic
1096604104 12:52752741-52752763 CTCAGGACACAGATGGAGCTGGG - Intergenic
1098472046 12:70856622-70856644 CAGAGGTCACACCTAGAGCTAGG + Intronic
1098686570 12:73429987-73430009 CTTAGTCCACAGGTAGAACTGGG - Intergenic
1101217425 12:102597966-102597988 TTAAGGTCACAGTTAGAGCTTGG + Intergenic
1101804285 12:108049985-108050007 CAGAGGAGACAGACAGAGCTGGG + Intergenic
1103510701 12:121471708-121471730 CAAAGGCCACAGCTAAAGCTTGG + Intronic
1104056395 12:125234152-125234174 CTGTGGCCAGGGATAGTGCTGGG + Intronic
1104694257 12:130851752-130851774 CTGAGGCCCCAGAAGGATCTGGG - Intergenic
1104992911 12:132636225-132636247 CTGGCGCCACAAAGAGAGCTGGG + Intronic
1106050835 13:26187889-26187911 CTGTGGTCTCAAATAGAGCTAGG - Intronic
1107285112 13:38781856-38781878 CTGAGCCCAGAGAGTGAGCTAGG + Intronic
1107381363 13:39860143-39860165 CTGAGGCCACACAGACAGCTTGG - Intergenic
1107838433 13:44431441-44431463 CTGTGCCCACCGATAGAACTTGG - Intergenic
1107934349 13:45332449-45332471 CTGAGTCCAGAGGTAGAGCAAGG - Intergenic
1109020839 13:57090431-57090453 CTGAGTCCATAGATAGAGAAGGG - Intergenic
1110817202 13:79875280-79875302 CTGAGGGCACAGATAGACTTGGG - Intergenic
1112161444 13:96872632-96872654 CTAAGGCCACAGGCAGAGATGGG - Intergenic
1112259640 13:97866753-97866775 CTGAGACCACAGAGGCAGCTAGG + Intergenic
1112630151 13:101152129-101152151 CTGAAGCCACAGATAGAAATTGG + Intronic
1113075207 13:106461337-106461359 CAGAGGACAAAGAAAGAGCTGGG + Intergenic
1113437315 13:110303337-110303359 CTGGGGCCTCAGTTGGAGCTGGG + Intronic
1113778348 13:112961653-112961675 CTGTGGCCACACACACAGCTGGG + Intronic
1115898387 14:38117394-38117416 CGGAGGCCACTGATAGAGGCAGG + Intergenic
1115918154 14:38341159-38341181 ATTAGGCAAAAGATAGAGCTAGG - Intergenic
1116589467 14:46752536-46752558 CTGTGGTGACAGCTAGAGCTGGG - Intergenic
1119509397 14:75199042-75199064 CTGAGGCAGCAGCCAGAGCTTGG + Intergenic
1119620182 14:76126001-76126023 GTGAGGCCACAGATGCTGCTGGG - Intergenic
1120346672 14:83299168-83299190 GTGAGGCTTCAGATAGAGCCAGG + Intergenic
1122397780 14:101446610-101446632 CTAAGGCCAAAGACAGAGCCAGG + Intergenic
1123443009 15:20303980-20304002 CTAAGGCCACAGATAGGACCAGG - Intergenic
1123920761 15:25068221-25068243 CTCAGGCCTCAGATAGACCTTGG + Intergenic
1125256224 15:37766566-37766588 CTGAGACTACAGATAGACCAAGG + Intergenic
1125535533 15:40439831-40439853 CTAAGGGCACAGAGAGAGATGGG - Intronic
1126391699 15:48162865-48162887 CTGAGGCGACGGAGAGAGATGGG - Intronic
1129300953 15:74625189-74625211 CTCAGGACACAGAGACAGCTGGG - Intronic
1129843691 15:78758626-78758648 CTGTGCCCAGAGATAGGGCTGGG - Intergenic
1130258112 15:82335174-82335196 CTGTGCCCAGAGATAGGGCTGGG + Intergenic
1130596819 15:85254788-85254810 CTGTGCCCAGAGATAGGGCTGGG - Intergenic
1130949419 15:88573711-88573733 CTGAGCCCACAGGTACAGTTGGG - Intergenic
1131070000 15:89460172-89460194 CAGAGGGATCAGATAGAGCTGGG + Intergenic
1131802825 15:96089547-96089569 CTGAGGCCAGAAATAGAGCTTGG + Intergenic
1133165911 16:3947085-3947107 CGGTGGCCACAGTTAGAGGTGGG - Intergenic
1133453400 16:5922184-5922206 CTGAGTTCACATAGAGAGCTAGG - Intergenic
1135976198 16:27110246-27110268 CAGCGGCCACGGATAGAGCCTGG + Intergenic
1137615863 16:49846622-49846644 TGGAGGCCACAGAGAGTGCTGGG - Intronic
1140132035 16:72171333-72171355 CTGAGGGCATAGATCCAGCTGGG - Intronic
1141568263 16:84918068-84918090 CTGAGGCCACAGAGCCAGCCCGG - Intronic
1141595140 16:85092786-85092808 CTAAGACCACAGACAGAGCAGGG + Exonic
1141685469 16:85567362-85567384 CTGAGGCCCCAGGTGTAGCTGGG - Intergenic
1142037305 16:87869875-87869897 CTGAGGCCAAGGATGGAGTTTGG + Intergenic
1142433049 16:90040804-90040826 CTGAGTCCACAGGTGGGGCTGGG + Intronic
1142489200 17:266964-266986 GTGAGGCCAGAGATGAAGCTTGG - Intronic
1144011206 17:11150044-11150066 CAGAGGCCCAAGATAGAGCTGGG + Intergenic
1144539237 17:16123023-16123045 GTGAGTCCAAAGATAGAGATTGG - Intronic
1145014881 17:19390176-19390198 AAGAGGCTACAGATACAGCTGGG + Intergenic
1147137266 17:38441531-38441553 CTGAGGCCCCAGAGAGGGCGGGG + Intronic
1147631994 17:41938241-41938263 CTGAGGACACAGCTTGAACTGGG + Intronic
1148630553 17:49104960-49104982 CAGAGGGCACAGATACAACTGGG + Intergenic
1148801003 17:50225794-50225816 CTGAAGCCACAGCTATACCTTGG + Intergenic
1149781943 17:59404752-59404774 CTGGGGCCACAGATAGGGTGTGG - Intergenic
1151508888 17:74546316-74546338 CTGAGGCCAGAAGAAGAGCTGGG - Intergenic
1152431771 17:80252222-80252244 CTGAGGTCACAGCTGAAGCTGGG + Intronic
1152597665 17:81245854-81245876 CAGAGGCCAGAGCCAGAGCTGGG - Exonic
1152976717 18:228180-228202 CTGTGGCCACAGCTAGACCTGGG + Intronic
1153981221 18:10312350-10312372 CTGAGCCCACAAACAGAGCTTGG - Intergenic
1156647573 18:39184797-39184819 CTGGTGCCACAGATAGCACTGGG - Intergenic
1156835794 18:41553110-41553132 CTGAGGCAAGTGAAAGAGCTAGG - Intergenic
1158264721 18:55649411-55649433 CTCAGGCCACCACTAGAGCTAGG + Intronic
1161242503 19:3230172-3230194 CTGAGGCCAGAGCTAGACATTGG + Intronic
1164628867 19:29747830-29747852 CTGAGGGCAGAGATTGAGCATGG + Intergenic
1165123358 19:33577712-33577734 CAGAGGCCTCAGACAGAGGTGGG - Intergenic
1165147039 19:33737466-33737488 CTGTGGCCATAATTAGAGCTGGG + Intronic
1165342625 19:35223744-35223766 CTGAGGTCACACAGTGAGCTTGG - Intergenic
1165464268 19:35963366-35963388 CTGTGGACACAGACAGACCTGGG - Intergenic
1165787026 19:38467753-38467775 CTGAGGCCTGATGTAGAGCTGGG + Exonic
1165855683 19:38878330-38878352 CTGAGGCCCCAGAAAGAGGGAGG - Intergenic
1166643112 19:44511473-44511495 CTAAGGCCTCACAGAGAGCTGGG - Intronic
925868603 2:8250291-8250313 TTGAGGCCACTGATATAGTTTGG + Intergenic
925909565 2:8564708-8564730 CTGAGGCGACAGGGAGACCTGGG + Intergenic
929163525 2:38857678-38857700 CTGAGGGCAAAGTTAGAGATAGG - Intronic
929694786 2:44105150-44105172 CAGAGGCCACATATCAAGCTCGG + Intergenic
929996329 2:46828396-46828418 ATGAGGACCCAGAGAGAGCTGGG - Intronic
930068099 2:47343181-47343203 CTCAGGACACAGATAGAATTTGG + Intergenic
930900583 2:56502842-56502864 CTGAAGCCAAAGAAACAGCTGGG - Intergenic
931150054 2:59562994-59563016 CTGATGCCCTAGACAGAGCTTGG - Intergenic
931621235 2:64211756-64211778 CTGAGGGAACAGACATAGCTGGG - Intergenic
931801754 2:65765528-65765550 CTGAGGAGCCAGAGAGAGCTGGG - Intergenic
931882371 2:66581290-66581312 CTTAGATCACAGATAGAACTAGG - Intergenic
932314838 2:70773134-70773156 CTGATGCCTCAGATAGACCCAGG + Intergenic
933476457 2:82798141-82798163 TTGAGGCCACAGAAAGAATTGGG + Intergenic
935329974 2:101969730-101969752 CAAAGGCCACAGGTACAGCTTGG - Intergenic
936087967 2:109482400-109482422 CTTTGGCAACAGATGGAGCTGGG - Intronic
937012795 2:118576754-118576776 CTGAGGCCTCAGCCAGATCTGGG + Intergenic
937580546 2:123481958-123481980 CTGAGACAAGAGAAAGAGCTAGG - Intergenic
943376235 2:187080459-187080481 CTGAGGTCAGAGATAAAGATTGG + Intergenic
943980857 2:194548493-194548515 CCTAGGCCTCAGAAAGAGCTGGG + Intergenic
944188123 2:196972023-196972045 TTGAGGGTACAGACAGAGCTTGG + Intronic
946389258 2:219405541-219405563 TTGAGGCCACAGATCAAGCCTGG + Intergenic
947719987 2:232364480-232364502 ATGAGGCCACTCACAGAGCTTGG - Intergenic
947864196 2:233384819-233384841 CTGGGGCTACAGACAGAGCCCGG - Intronic
948282673 2:236760084-236760106 CTGGGGCTACAGCTGGAGCTGGG - Intergenic
948652578 2:239457695-239457717 GTGAAGCCCCAGATAGAGCCAGG + Intergenic
1170760993 20:19251570-19251592 CTGAGACCCCGGCTAGAGCTGGG - Intronic
1170939779 20:20839369-20839391 CTGGATGCACAGATAGAGCTTGG + Intergenic
1171941035 20:31330224-31330246 CAGAGGCCTCAGCTGGAGCTGGG - Intergenic
1171992403 20:31706887-31706909 ATGAGGCAACAGGCAGAGCTTGG + Intronic
1172012192 20:31851937-31851959 CTGAGGCCATACAATGAGCTGGG - Intronic
1172110636 20:32542828-32542850 CTGACACCAGAGCTAGAGCTTGG - Intronic
1173221362 20:41135654-41135676 CTGATGCCAGAGAAAGAGCCAGG - Intergenic
1173866667 20:46316920-46316942 CTGAGGCCACAGATGGGACAAGG + Intergenic
1173926528 20:46785194-46785216 ATGAGGTCTCAGAGAGAGCTGGG - Intergenic
1174009602 20:47439009-47439031 CCTAGGCAACAGAAAGAGCTGGG + Intergenic
1174403278 20:50287771-50287793 CTGAGGCCACAGGTGGTGGTGGG - Intergenic
1174986027 20:55452820-55452842 CTGAGGAGACAGAGAGAACTGGG + Intergenic
1175474418 20:59260783-59260805 CTGTGGCCACAGACAGAACTGGG - Intergenic
1175873405 20:62218853-62218875 CAGGGGACACAGATAGTGCTGGG - Intronic
1175940783 20:62536653-62536675 CTGAGGCCACACAAAGTGCCAGG - Intergenic
1176000012 20:62827454-62827476 CTGGGGCCAGGGAGAGAGCTCGG - Intronic
1176915261 21:14618049-14618071 CTAAGACCACAAATAGAGATTGG + Intronic
1178878391 21:36429864-36429886 CCGAGGGCACACCTAGAGCTGGG - Intergenic
1179010828 21:37554807-37554829 CAGAGGCCAGAGGCAGAGCTTGG + Intergenic
1181632850 22:24160417-24160439 CCAAGGTGACAGATAGAGCTGGG + Intronic
1182009281 22:26986761-26986783 CTGGGGCCAGAAACAGAGCTGGG - Intergenic
1184828839 22:46971298-46971320 CTGAGTGCACAGATGCAGCTGGG - Intronic
1184997792 22:48223164-48223186 GGGAGGCCACAGATTGAGCTGGG + Intergenic
1185400369 22:50612582-50612604 CTGAGGCCCCAGAGAGACCGAGG + Intronic
949849259 3:8405972-8405994 CTGAGGCCTCAGACAGACGTGGG + Intergenic
950131873 3:10552827-10552849 CTGAGGCCACAGACAGCTCAGGG + Intronic
952084212 3:29798018-29798040 CTGAGGACAAAGAAAGAGATGGG + Intronic
953446314 3:42971168-42971190 CAGAGGCCACAGAATTAGCTTGG + Intronic
953912613 3:46900532-46900554 CAGAGGCCACAGGGAGACCTCGG - Intronic
953970709 3:47344798-47344820 CTGAGGCCTCGCATTGAGCTGGG + Exonic
954301699 3:49703840-49703862 CTGAGGGCACAGCGAGAGCAAGG + Intronic
955608843 3:60735760-60735782 ATTAAGCCACAGTTAGAGCTAGG + Intronic
956849549 3:73216452-73216474 CTGTGGCCAGTAATAGAGCTGGG + Intergenic
957165259 3:76664110-76664132 CTGAGGACACAGCTAGAATTAGG + Intronic
959083707 3:101829188-101829210 CTGAGGCCAAAGACACAGTTGGG + Intronic
960244064 3:115380333-115380355 CAAGGGCCACAGATATAGCTTGG - Intergenic
961591989 3:127988161-127988183 CTGAGGCCACACCGAGAGTTGGG + Intergenic
961743887 3:129051063-129051085 CTGAGGCCACGGAAAGAGAGGGG + Intergenic
965333710 3:167409254-167409276 ATGATGCCACAGGGAGAGCTAGG - Intergenic
967102101 3:186223969-186223991 CTGGGGCCACACCTACAGCTGGG - Intronic
968680680 4:1916913-1916935 GTGACGCCCCAGAAAGAGCTTGG + Exonic
968903507 4:3441790-3441812 CCGAGGCCAGAGAGACAGCTGGG + Intergenic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
970031057 4:11675225-11675247 CAGAAGCCAGACATAGAGCTTGG + Intergenic
972382375 4:38531327-38531349 CTGAGGAACCAGACAGAGCTGGG + Intergenic
975528191 4:75373947-75373969 CTGAGGACACAGCTAGAGGGAGG + Intergenic
980670692 4:136002037-136002059 CTGAGCCACCAGATAGAGTTTGG - Intergenic
981775463 4:148362087-148362109 CTCAGGCCACCCATAGTGCTGGG + Intronic
982912681 4:161164561-161164583 CAGAGGCCAGGGATAGAGGTGGG - Intergenic
984215268 4:176904664-176904686 CAGAGGCTACAGATAGACATTGG - Intergenic
986475866 5:8131681-8131703 CTGTGGCTACAGATAGATGTGGG - Intergenic
986736005 5:10667750-10667772 CTGAGGCCCCAGAGGGAGCATGG - Intergenic
987224126 5:15821972-15821994 CTGAGGCAGCAAACAGAGCTTGG - Intronic
990033648 5:51292480-51292502 CTGACCCCAGAGATAGGGCTAGG + Intergenic
990831565 5:59964745-59964767 CTGTGGCTACTGATAGAGATTGG - Intronic
991006609 5:61834138-61834160 CAAAGGCAACAGGTAGAGCTGGG - Intergenic
993914279 5:93723212-93723234 CTAAGGCAACAGATTAAGCTGGG + Intronic
995894286 5:116994521-116994543 CTGGGGACCCAGATAGACCTGGG - Intergenic
998151121 5:139758134-139758156 AGGAGGCCACAGATAGATGTAGG + Intergenic
998859765 5:146430836-146430858 ATTAGGCAACAGAGAGAGCTAGG + Intergenic
998942619 5:147301096-147301118 TTGAGGTTACAGAAAGAGCTTGG + Intronic
999032516 5:148309496-148309518 CTGAGGCTACAGAAAGATCTAGG - Intergenic
999128757 5:149266587-149266609 CTGCAGCCACAGATGAAGCTAGG + Intergenic
1000197306 5:158972182-158972204 CTGGGGACACAGATTGAGGTGGG - Intronic
1001427644 5:171634195-171634217 CTGAGGCCACTGAGAAACCTGGG - Intergenic
1001681612 5:173561964-173561986 CTGTGGCCACAGGTACTGCTGGG + Intergenic
1002109355 5:176897831-176897853 CTGAGGCCAAAGGTAGATTTGGG - Intronic
1002764318 6:226247-226269 CAGAGCCAACAGACAGAGCTGGG + Intergenic
1003850547 6:10218099-10218121 CAGAAGCCACAGAAAGAACTGGG - Intergenic
1005603229 6:27448558-27448580 ATGAGGTCAGAGAGAGAGCTGGG - Intergenic
1006460137 6:34153311-34153333 CTGAGGCCAGAGACTGAGCCAGG - Intronic
1007905844 6:45460016-45460038 ATGAGGCCACAGAGATAGTTGGG + Intronic
1012395373 6:98790446-98790468 CTAAGGCCACAGCCAGAGTTGGG - Intergenic
1012687088 6:102265531-102265553 CTTATGCCCCAGATAGTGCTAGG + Intergenic
1017507432 6:155081521-155081543 CTGAGCCCTGAGATAAAGCTAGG + Intronic
1017768260 6:157624634-157624656 GTTAGGAGACAGATAGAGCTGGG + Intronic
1018172582 6:161153785-161153807 CTGAGGTCACACATAGCCCTGGG + Intronic
1019109320 6:169697365-169697387 CTGAGGCTACCGCTAGACCTCGG - Intronic
1019493688 7:1326522-1326544 CTGTGGCCACGTATAGTGCTCGG + Intergenic
1020581124 7:10003800-10003822 CTGAGGCCACAGGTATTGCTAGG - Intergenic
1020638614 7:10727750-10727772 CTGAGGTCAAGGAGAGAGCTTGG - Intergenic
1024585621 7:50839379-50839401 CTAAGGCAACAAAAAGAGCTAGG + Intergenic
1025030825 7:55555291-55555313 CTGGGGCCAGCGATTGAGCTGGG - Intronic
1028456352 7:91042109-91042131 CTGAAGCTACAAATAGAGGTAGG + Intronic
1028856972 7:95603707-95603729 CAGAGGCCACAAAGAGAGCCAGG - Intergenic
1029481403 7:100815475-100815497 CTAAGGCAACAGAAAGATCTGGG + Intronic
1031132004 7:117843618-117843640 TTGAGGCCACAGAAAGGCCTTGG + Intronic
1034466678 7:151233876-151233898 ATGAGGCCAAAGACAGAGCGAGG - Exonic
1035028993 7:155845074-155845096 CTGTGACCACAGATAGAAATCGG - Intergenic
1038065664 8:23961385-23961407 CTATGGCCACAGAATGAGCTGGG - Intergenic
1038441817 8:27575949-27575971 CTCAGACCCCAGAGAGAGCTGGG + Intergenic
1038500880 8:28042542-28042564 CTGAGTCCCCAGGTAGAGGTGGG + Intronic
1039622393 8:39010307-39010329 CTGTGGCAATAGAAAGAGCTTGG + Intronic
1040100731 8:43500844-43500866 CTCAGGCCACAAAGAGAGCCTGG - Intergenic
1041468368 8:58180651-58180673 CTGAGGCCACAGATAGAGCTAGG - Intronic
1044089787 8:87984986-87985008 CTGAGGAGACAGAGAGAGATGGG + Intergenic
1048190110 8:132280622-132280644 CTGTGACCACTGATAGAGTTTGG - Intronic
1048320934 8:133399760-133399782 CTGTGGCCAGACACAGAGCTGGG + Intergenic
1049798781 8:144508380-144508402 CTGAAGCCACAGACACAGCAAGG + Intergenic
1050486763 9:6142628-6142650 CTGTGGCCACAGCTAGGACTTGG + Intergenic
1050836199 9:10081958-10081980 CTTAGGCCACAGAGAGATTTAGG + Intronic
1053496028 9:38548603-38548625 CTGAGGCTGCACATAGAGCGGGG + Intronic
1055807669 9:80114982-80115004 TTGATGACACAGAAAGAGCTTGG + Intergenic
1057314617 9:93960449-93960471 CTGAGGCCACACCCAGAGCCAGG + Intergenic
1057427824 9:94968055-94968077 CAAAGGCCACAGATTGCGCTTGG - Intronic
1057825933 9:98372042-98372064 CTGAGCCCACACTTAGACCTTGG + Intronic
1059432224 9:114257169-114257191 CTGAGGCACCAGATGGGGCTGGG + Intronic
1059762204 9:117349031-117349053 CTGGTGCCATAGAGAGAGCTAGG + Intronic
1060793090 9:126498665-126498687 CTGAGGTCCCAGAGTGAGCTGGG - Intronic
1061757793 9:132827473-132827495 CTGTGGTGGCAGATAGAGCTGGG - Intronic
1062461138 9:136663020-136663042 CTGAGGCCCCAGCAAGGGCTAGG + Intronic
1185481538 X:450134-450156 CTCAGCCAACAGATAGAGATGGG + Intergenic
1185481565 X:450289-450311 CTCAGCCAACAGATAGAGATGGG + Intergenic
1185481591 X:450444-450466 CTCAGCCAACAGATAGAGATGGG + Intergenic
1185481615 X:450599-450621 CTCAGCCAACAGATAGAGATGGG + Intergenic
1187019403 X:15364668-15364690 CTGAGGCCATTTGTAGAGCTGGG + Intronic
1187475381 X:19606308-19606330 CTGTGGCATCAGATAGATCTGGG - Intronic
1189155135 X:38749373-38749395 CCCAGGCCTCAGCTAGAGCTGGG - Intergenic
1190170902 X:48110843-48110865 GTGATGCCACAGAGACAGCTGGG - Intergenic
1190875900 X:54459846-54459868 CTGGGGCCTCAGATAGGGTTGGG + Intronic
1193936931 X:87634756-87634778 GTGAGGCCACGGATAGATTTAGG - Intronic
1199243070 X:145570898-145570920 GTAAGGACACAGATAGAGTTTGG + Intergenic
1199713221 X:150487031-150487053 CTGACTCCACAGATACAGGTGGG + Intronic