ID: 1041470984

View in Genome Browser
Species Human (GRCh38)
Location 8:58208831-58208853
Sequence GTGGAGGGATGCAGGCTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041470984_1041470991 16 Left 1041470984 8:58208831-58208853 CCTGGGAGCCTGCATCCCTCCAC No data
Right 1041470991 8:58208870-58208892 TGTCTTCATCCCAAGTGCAAGGG No data
1041470984_1041470992 17 Left 1041470984 8:58208831-58208853 CCTGGGAGCCTGCATCCCTCCAC No data
Right 1041470992 8:58208871-58208893 GTCTTCATCCCAAGTGCAAGGGG No data
1041470984_1041470990 15 Left 1041470984 8:58208831-58208853 CCTGGGAGCCTGCATCCCTCCAC No data
Right 1041470990 8:58208869-58208891 CTGTCTTCATCCCAAGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041470984 Original CRISPR GTGGAGGGATGCAGGCTCCC AGG (reversed) Intergenic
No off target data available for this crispr