ID: 1041472404

View in Genome Browser
Species Human (GRCh38)
Location 8:58225365-58225387
Sequence CAGCCCTGAGACCTTGGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041472404_1041472409 30 Left 1041472404 8:58225365-58225387 CCACTGCCAAGGTCTCAGGGCTG No data
Right 1041472409 8:58225418-58225440 TCTAGACTTCCCTCAACTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041472404 Original CRISPR CAGCCCTGAGACCTTGGCAG TGG (reversed) Intergenic
No off target data available for this crispr