ID: 1041476828

View in Genome Browser
Species Human (GRCh38)
Location 8:58276803-58276825
Sequence AGAGCTAGGTTGCCTGGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041476828_1041476832 -4 Left 1041476828 8:58276803-58276825 CCAAAACCAGGCAACCTAGCTCT No data
Right 1041476832 8:58276822-58276844 CTCTGCCTCCTGGCTGTGTCAGG No data
1041476828_1041476838 25 Left 1041476828 8:58276803-58276825 CCAAAACCAGGCAACCTAGCTCT No data
Right 1041476838 8:58276851-58276873 GGATCTCAAGAATGTTAGTTGGG No data
1041476828_1041476834 3 Left 1041476828 8:58276803-58276825 CCAAAACCAGGCAACCTAGCTCT No data
Right 1041476834 8:58276829-58276851 TCCTGGCTGTGTCAGGCTGATGG No data
1041476828_1041476836 4 Left 1041476828 8:58276803-58276825 CCAAAACCAGGCAACCTAGCTCT No data
Right 1041476836 8:58276830-58276852 CCTGGCTGTGTCAGGCTGATGGG No data
1041476828_1041476837 24 Left 1041476828 8:58276803-58276825 CCAAAACCAGGCAACCTAGCTCT No data
Right 1041476837 8:58276850-58276872 GGGATCTCAAGAATGTTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041476828 Original CRISPR AGAGCTAGGTTGCCTGGTTT TGG (reversed) Intergenic