ID: 1041476829

View in Genome Browser
Species Human (GRCh38)
Location 8:58276809-58276831
Sequence GGAGGCAGAGCTAGGTTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041476829_1041476838 19 Left 1041476829 8:58276809-58276831 CCAGGCAACCTAGCTCTGCCTCC No data
Right 1041476838 8:58276851-58276873 GGATCTCAAGAATGTTAGTTGGG No data
1041476829_1041476834 -3 Left 1041476829 8:58276809-58276831 CCAGGCAACCTAGCTCTGCCTCC No data
Right 1041476834 8:58276829-58276851 TCCTGGCTGTGTCAGGCTGATGG No data
1041476829_1041476837 18 Left 1041476829 8:58276809-58276831 CCAGGCAACCTAGCTCTGCCTCC No data
Right 1041476837 8:58276850-58276872 GGGATCTCAAGAATGTTAGTTGG No data
1041476829_1041476836 -2 Left 1041476829 8:58276809-58276831 CCAGGCAACCTAGCTCTGCCTCC No data
Right 1041476836 8:58276830-58276852 CCTGGCTGTGTCAGGCTGATGGG No data
1041476829_1041476832 -10 Left 1041476829 8:58276809-58276831 CCAGGCAACCTAGCTCTGCCTCC No data
Right 1041476832 8:58276822-58276844 CTCTGCCTCCTGGCTGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041476829 Original CRISPR GGAGGCAGAGCTAGGTTGCC TGG (reversed) Intergenic