ID: 1041476831

View in Genome Browser
Species Human (GRCh38)
Location 8:58276817-58276839
Sequence CACAGCCAGGAGGCAGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041476831_1041476836 -10 Left 1041476831 8:58276817-58276839 CCTAGCTCTGCCTCCTGGCTGTG No data
Right 1041476836 8:58276830-58276852 CCTGGCTGTGTCAGGCTGATGGG No data
1041476831_1041476838 11 Left 1041476831 8:58276817-58276839 CCTAGCTCTGCCTCCTGGCTGTG No data
Right 1041476838 8:58276851-58276873 GGATCTCAAGAATGTTAGTTGGG No data
1041476831_1041476837 10 Left 1041476831 8:58276817-58276839 CCTAGCTCTGCCTCCTGGCTGTG No data
Right 1041476837 8:58276850-58276872 GGGATCTCAAGAATGTTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041476831 Original CRISPR CACAGCCAGGAGGCAGAGCT AGG (reversed) Intergenic