ID: 1041476833

View in Genome Browser
Species Human (GRCh38)
Location 8:58276827-58276849
Sequence ATCAGCCTGACACAGCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041476833_1041476843 29 Left 1041476833 8:58276827-58276849 CCTCCTGGCTGTGTCAGGCTGAT No data
Right 1041476843 8:58276879-58276901 CTCTTCCTCTATCAAATGGAGGG No data
1041476833_1041476837 0 Left 1041476833 8:58276827-58276849 CCTCCTGGCTGTGTCAGGCTGAT No data
Right 1041476837 8:58276850-58276872 GGGATCTCAAGAATGTTAGTTGG No data
1041476833_1041476842 28 Left 1041476833 8:58276827-58276849 CCTCCTGGCTGTGTCAGGCTGAT No data
Right 1041476842 8:58276878-58276900 CCTCTTCCTCTATCAAATGGAGG No data
1041476833_1041476838 1 Left 1041476833 8:58276827-58276849 CCTCCTGGCTGTGTCAGGCTGAT No data
Right 1041476838 8:58276851-58276873 GGATCTCAAGAATGTTAGTTGGG No data
1041476833_1041476844 30 Left 1041476833 8:58276827-58276849 CCTCCTGGCTGTGTCAGGCTGAT No data
Right 1041476844 8:58276880-58276902 TCTTCCTCTATCAAATGGAGGGG No data
1041476833_1041476839 25 Left 1041476833 8:58276827-58276849 CCTCCTGGCTGTGTCAGGCTGAT No data
Right 1041476839 8:58276875-58276897 CTCCCTCTTCCTCTATCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041476833 Original CRISPR ATCAGCCTGACACAGCCAGG AGG (reversed) Intergenic