ID: 1041476837

View in Genome Browser
Species Human (GRCh38)
Location 8:58276850-58276872
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041476829_1041476837 18 Left 1041476829 8:58276809-58276831 CCAGGCAACCTAGCTCTGCCTCC No data
Right 1041476837 8:58276850-58276872 GGGATCTCAAGAATGTTAGTTGG No data
1041476828_1041476837 24 Left 1041476828 8:58276803-58276825 CCAAAACCAGGCAACCTAGCTCT No data
Right 1041476837 8:58276850-58276872 GGGATCTCAAGAATGTTAGTTGG No data
1041476833_1041476837 0 Left 1041476833 8:58276827-58276849 CCTCCTGGCTGTGTCAGGCTGAT No data
Right 1041476837 8:58276850-58276872 GGGATCTCAAGAATGTTAGTTGG No data
1041476835_1041476837 -3 Left 1041476835 8:58276830-58276852 CCTGGCTGTGTCAGGCTGATGGG No data
Right 1041476837 8:58276850-58276872 GGGATCTCAAGAATGTTAGTTGG No data
1041476831_1041476837 10 Left 1041476831 8:58276817-58276839 CCTAGCTCTGCCTCCTGGCTGTG No data
Right 1041476837 8:58276850-58276872 GGGATCTCAAGAATGTTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041476837 Original CRISPR GGGATCTCAAGAATGTTAGT TGG Intergenic
No off target data available for this crispr