ID: 1041477109

View in Genome Browser
Species Human (GRCh38)
Location 8:58278827-58278849
Sequence CAGCCAGAAGTCCTTGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041477109_1041477114 10 Left 1041477109 8:58278827-58278849 CCCAGGGCAAGGACTTCTGGCTG No data
Right 1041477114 8:58278860-58278882 AGCTTCCTCCCAGAGGCCCCAGG No data
1041477109_1041477122 30 Left 1041477109 8:58278827-58278849 CCCAGGGCAAGGACTTCTGGCTG No data
Right 1041477122 8:58278880-58278902 AGGTGGCTGCTACCACCACATGG No data
1041477109_1041477113 3 Left 1041477109 8:58278827-58278849 CCCAGGGCAAGGACTTCTGGCTG No data
Right 1041477113 8:58278853-58278875 TTTGGGTAGCTTCCTCCCAGAGG No data
1041477109_1041477115 13 Left 1041477109 8:58278827-58278849 CCCAGGGCAAGGACTTCTGGCTG No data
Right 1041477115 8:58278863-58278885 TTCCTCCCAGAGGCCCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041477109 Original CRISPR CAGCCAGAAGTCCTTGCCCT GGG (reversed) Intergenic
No off target data available for this crispr