ID: 1041481546

View in Genome Browser
Species Human (GRCh38)
Location 8:58326440-58326462
Sequence CTGTTCCAGTATAGCATTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041481546_1041481548 27 Left 1041481546 8:58326440-58326462 CCTTAAATGCTATACTGGAACAG No data
Right 1041481548 8:58326490-58326512 TCCACCCTAACAATCTGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041481546 Original CRISPR CTGTTCCAGTATAGCATTTA AGG (reversed) Intergenic
No off target data available for this crispr