ID: 1041483130

View in Genome Browser
Species Human (GRCh38)
Location 8:58345150-58345172
Sequence AATTTTCCACAGATGGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041483120_1041483130 18 Left 1041483120 8:58345109-58345131 CCCAACGTTTTTAGCACCAGGGA No data
Right 1041483130 8:58345150-58345172 AATTTTCCACAGATGGGGTGGGG No data
1041483118_1041483130 19 Left 1041483118 8:58345108-58345130 CCCCAACGTTTTTAGCACCAGGG No data
Right 1041483130 8:58345150-58345172 AATTTTCCACAGATGGGGTGGGG No data
1041483121_1041483130 17 Left 1041483121 8:58345110-58345132 CCAACGTTTTTAGCACCAGGGAC No data
Right 1041483130 8:58345150-58345172 AATTTTCCACAGATGGGGTGGGG No data
1041483124_1041483130 -5 Left 1041483124 8:58345132-58345154 CCAGTTTCATGGAAGACAAATTT No data
Right 1041483130 8:58345150-58345172 AATTTTCCACAGATGGGGTGGGG No data
1041483123_1041483130 2 Left 1041483123 8:58345125-58345147 CCAGGGACCAGTTTCATGGAAGA 0: 275
1: 558
2: 1130
3: 1239
4: 1262
Right 1041483130 8:58345150-58345172 AATTTTCCACAGATGGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041483130 Original CRISPR AATTTTCCACAGATGGGGTG GGG Intergenic
No off target data available for this crispr