ID: 1041485093

View in Genome Browser
Species Human (GRCh38)
Location 8:58367383-58367405
Sequence ACTTACTTTTGGAGTGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041485093_1041485099 20 Left 1041485093 8:58367383-58367405 CCTCCCACACTCCAAAAGTAAGT No data
Right 1041485099 8:58367426-58367448 TTTATTCCATTTATCCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041485093 Original CRISPR ACTTACTTTTGGAGTGTGGG AGG (reversed) Intergenic
No off target data available for this crispr