ID: 1041488346

View in Genome Browser
Species Human (GRCh38)
Location 8:58404059-58404081
Sequence CTGGTGTTCCTAAGTACAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041488343_1041488346 2 Left 1041488343 8:58404034-58404056 CCCAAGGGTAGTGCTGAAGTACT No data
Right 1041488346 8:58404059-58404081 CTGGTGTTCCTAAGTACAAGAGG No data
1041488342_1041488346 3 Left 1041488342 8:58404033-58404055 CCCCAAGGGTAGTGCTGAAGTAC No data
Right 1041488346 8:58404059-58404081 CTGGTGTTCCTAAGTACAAGAGG No data
1041488341_1041488346 4 Left 1041488341 8:58404032-58404054 CCCCCAAGGGTAGTGCTGAAGTA No data
Right 1041488346 8:58404059-58404081 CTGGTGTTCCTAAGTACAAGAGG No data
1041488344_1041488346 1 Left 1041488344 8:58404035-58404057 CCAAGGGTAGTGCTGAAGTACTG No data
Right 1041488346 8:58404059-58404081 CTGGTGTTCCTAAGTACAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041488346 Original CRISPR CTGGTGTTCCTAAGTACAAG AGG Intergenic
No off target data available for this crispr