ID: 1041488551

View in Genome Browser
Species Human (GRCh38)
Location 8:58406581-58406603
Sequence GAGCCTACTGTTAAATTTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041488551_1041488552 -5 Left 1041488551 8:58406581-58406603 CCTAAAAATTTAACAGTAGGCTC No data
Right 1041488552 8:58406599-58406621 GGCTCTCATAAGCCAGTGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041488551 Original CRISPR GAGCCTACTGTTAAATTTTT AGG (reversed) Intergenic
No off target data available for this crispr