ID: 1041489093

View in Genome Browser
Species Human (GRCh38)
Location 8:58411567-58411589
Sequence GCCTTTCCCCGACCCCGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1014
Summary {0: 1, 1: 0, 2: 0, 3: 65, 4: 948}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041489089_1041489093 -3 Left 1041489089 8:58411547-58411569 CCACCTCTGGCCTCGGCGGAGCC 0: 1
1: 0
2: 1
3: 26
4: 225
Right 1041489093 8:58411567-58411589 GCCTTTCCCCGACCCCGTCTGGG 0: 1
1: 0
2: 0
3: 65
4: 948
1041489090_1041489093 -6 Left 1041489090 8:58411550-58411572 CCTCTGGCCTCGGCGGAGCCTTT 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1041489093 8:58411567-58411589 GCCTTTCCCCGACCCCGTCTGGG 0: 1
1: 0
2: 0
3: 65
4: 948

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041489093 Original CRISPR GCCTTTCCCCGACCCCGTCT GGG Intronic
900307569 1:2018817-2018839 TCCTCTCCCCGCCCCCGTCGAGG + Intergenic
900669119 1:3838928-3838950 GGCTTTCCTCCACTCCGTCTGGG + Intronic
901100613 1:6715860-6715882 GCCCGGCCCCCACCCCGTCTGGG - Intergenic
901555642 1:10029221-10029243 GCCTGGCCACCACCCCGTCTGGG + Intergenic
901734856 1:11305936-11305958 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
902735462 1:18397854-18397876 TCCTTTCCCCAACTCTGTCTGGG - Intergenic
903163016 1:21502849-21502871 GCCCCGCCGCGACCCCGTCTGGG - Intergenic
903205933 1:21782749-21782771 TCCTTTCCCCTACCCCGCCCGGG + Intronic
903344853 1:22677398-22677420 GCCTTTCCCCTTCCCCTTGTAGG - Intergenic
903426428 1:23257494-23257516 GCCCTGCCGCGACCCCATCTGGG + Intergenic
903485832 1:23688869-23688891 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
903508135 1:23853157-23853179 GCCCGGCCGCGACCCCGTCTGGG + Intronic
903634388 1:24800537-24800559 GCCTGGCCACCACCCCGTCTGGG + Intronic
903637457 1:24832801-24832823 GCCCGGCCACGACCCCGTCTGGG - Intronic
903748361 1:25603669-25603691 GCCTGGCCGCCACCCCGTCTGGG + Intergenic
903894727 1:26596158-26596180 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
903993204 1:27288873-27288895 GCCTGGCCACCACCCCGTCTGGG - Intronic
903993388 1:27289376-27289398 GCCCGGCCGCGACCCCGTCTGGG - Intronic
904784325 1:32973994-32974016 GCCCGGCCACGACCCCGTCTGGG - Intergenic
904831548 1:33309289-33309311 GCCTGGCCGCCACCCCGTCTGGG - Intronic
904857366 1:33509502-33509524 GCCCGGCCGCGACCCCGTCTAGG - Intergenic
904930315 1:34082234-34082256 GCCCGGCCGCGACCCCGTCTGGG + Intronic
904930429 1:34082546-34082568 GCCCGTCCACCACCCCGTCTGGG + Intronic
905315574 1:37080460-37080482 GCCCTGCCGCGACCCCGTCTGGG + Intergenic
905316016 1:37081598-37081620 GCCCGGCCACGACCCCGTCTGGG + Intergenic
905527051 1:38647490-38647512 GCCCTGCCGCGACCCCGTCTGGG + Intergenic
905599192 1:39234820-39234842 GCCCAGCCGCGACCCCGTCTGGG - Intronic
905673397 1:39808094-39808116 GCCTGGCCGCCACCCCGTCTGGG + Intergenic
906036134 1:42751040-42751062 GCCCAGCCACGACCCCGTCTGGG + Intronic
906308777 1:44738530-44738552 GCCCCGCCGCGACCCCGTCTGGG + Intergenic
906329924 1:44876386-44876408 GCCTGGCCGCGACCCTGTCTGGG + Intronic
906357008 1:45115492-45115514 GCCCGGCCGCGACCCCGTCTGGG - Intronic
906367561 1:45223323-45223345 GCCCGGCCACGACCCCGTCTGGG + Intronic
906427532 1:45725560-45725582 GCCCGGCCACGACCCCGTCTGGG + Intronic
906741930 1:48192422-48192444 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
906761346 1:48382228-48382250 GCCCGGCCACGACCCCGTCTGGG - Intronic
906770586 1:48479379-48479401 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
907140544 1:52181764-52181786 GCCTGGCTGCGACCCCGTCTGGG + Intronic
907216646 1:52870059-52870081 GCCCGGCCGCGACCCCGTCTGGG - Intronic
907402435 1:54233301-54233323 GCCCGGCCGCGACCCCGTCTGGG + Intronic
908370672 1:63474367-63474389 GCCCGGCCACGACCCCGTCTGGG + Intronic
908446353 1:64201742-64201764 GCCCGGCCACGACCCCGTCTGGG + Intergenic
909623067 1:77687415-77687437 GCCTGGCCCCCACCCCCTCTAGG + Intergenic
909623090 1:77687495-77687517 GCCTGGCCCCCACCCCGTCTAGG + Intergenic
909640791 1:77869465-77869487 GCCCGGCCACGACCCCGTCTGGG - Intronic
910343748 1:86215783-86215805 GCCTGGCCGAGACCCCGTCTGGG + Intergenic
910406982 1:86899902-86899924 GCCCGGCCGCGACCCCGTCTGGG - Intronic
910412749 1:86964029-86964051 GCCCGGCCGCGACCCCGTCTGGG - Intronic
910412797 1:86964224-86964246 GCCTGGCCGCCACCCCGTCTGGG - Intronic
910673813 1:89798127-89798149 GCCCGGCCGCGACCCCGTCTGGG - Intronic
910891675 1:92026200-92026222 GCCTGGCCGCCACCCCGTCTGGG - Intergenic
911601992 1:99856962-99856984 GCCTAGCCACCACCCCGTCTGGG - Intronic
912033101 1:105274565-105274587 GCCTATCCCTGACCCCACCTGGG - Intergenic
912298617 1:108490416-108490438 GCCTGGCCGCCACCCCGTCTGGG - Intergenic
912355739 1:109053289-109053311 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
912358386 1:109073971-109073993 GCCCGGCCACGACCCCGTCTGGG + Intronic
912752191 1:112294497-112294519 GCCCGGCCACGACCCCGTCTGGG + Intergenic
912825065 1:112898146-112898168 GCCTGGCCACCACCCCGTCTGGG - Intergenic
912844064 1:113063732-113063754 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
913022837 1:114804685-114804707 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
913994295 1:143639068-143639090 GCCCGGCCACGACCCCGTCTGGG + Intergenic
914230925 1:145764478-145764500 GCCCGGCCGCGACCCCGTCTGGG + Intronic
914787862 1:150850691-150850713 GCCTGGCCGCCACCCCGTCTGGG + Intronic
914787925 1:150850923-150850945 GCCCGGCCACGACCCCGTCTGGG + Intronic
914888346 1:151601194-151601216 GCCCGGCCACGACCCCGTCTGGG + Intergenic
914893872 1:151651556-151651578 GCCTGGCCGCGACCCCGTCTGGG - Intronic
914959459 1:152193607-152193629 GTCTTTCCCAGTCCCCCTCTGGG + Intergenic
914959951 1:152196655-152196677 GCCCTGCCGCGACCCCGTCTGGG - Intergenic
914959988 1:152196810-152196832 GCCTGACCACCACCCCGTCTGGG - Intergenic
915112759 1:153575115-153575137 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
915502317 1:156327929-156327951 GCCCAGCCGCGACCCCGTCTGGG + Intronic
915539852 1:156558594-156558616 GCCCGGCCACGACCCCGTCTGGG + Intronic
915861542 1:159449837-159449859 GCCCAGCCACGACCCCGTCTGGG + Intergenic
915992515 1:160531815-160531837 GCCTAGCCGCCACCCCGTCTAGG + Intergenic
916037840 1:160936711-160936733 GCCTGGCCACCACCCCGTCTGGG - Intergenic
916131667 1:161616719-161616741 GCCCGGCCGCGACCCCGTCTGGG - Intronic
916663763 1:166947448-166947470 GCCTTTCCCAGACCCTCTCATGG + Intronic
916671930 1:167029654-167029676 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
916759905 1:167806592-167806614 GCCTGGCCGCCACCCCGTCTAGG - Intergenic
916864111 1:168837394-168837416 GCCCAGCCGCGACCCCGTCTGGG + Intergenic
917006156 1:170418934-170418956 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
917126687 1:171694040-171694062 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
917304572 1:173613232-173613254 GCCCGGCCGCGACCCCGTCTGGG + Intronic
918061127 1:181062287-181062309 GCCTTGCCCCCACTCCGTGTTGG + Intergenic
918172395 1:182010635-182010657 GCCTGGCCACCACCCCGTCTGGG + Intergenic
918172451 1:182010867-182010889 GCCTGGCCGCGACCCCATCTGGG + Intergenic
918221439 1:182439984-182440006 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
918812526 1:189139969-189139991 GCCCCGCCGCGACCCCGTCTGGG - Intergenic
918818816 1:189225809-189225831 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
918818961 1:189226200-189226222 GCCTGGCCACCACCCCGTCTGGG + Intergenic
919625180 1:199904367-199904389 GCCTGGCCACCACCCCGTCTGGG - Intergenic
920451492 1:206064073-206064095 GCCCAGCCGCGACCCCGTCTGGG + Intronic
921139985 1:212298342-212298364 GCCCGGCCACGACCCCGTCTGGG - Intronic
921414355 1:214870077-214870099 GCCCTGCCGAGACCCCGTCTGGG - Intergenic
921814270 1:219546340-219546362 GCCGGGCCACGACCCCGTCTGGG + Intergenic
921902807 1:220466833-220466855 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
922306553 1:224350019-224350041 GCCTGGCCGCGACCCCATCTGGG - Intergenic
922436937 1:225615684-225615706 GCCCAGCCGCGACCCCGTCTGGG + Intronic
922503941 1:226115553-226115575 GCCTGGCCGCCACCCCGTCTGGG - Intergenic
922644862 1:227276243-227276265 GCCCGGCCGCGACCCCGTCTGGG + Intronic
923174860 1:231454194-231454216 GCCCGGCCACGACCCCGTCTGGG + Intergenic
923468140 1:234267401-234267423 GCCCGGCCACGACCCCGTCTGGG - Intronic
923711115 1:236387470-236387492 GCCTGGCCACCACCCCGTCTGGG + Intronic
923793050 1:237127699-237127721 GCCCGGCCGCGACCCCGTCTGGG - Intronic
924765959 1:247032246-247032268 GCCCGGCCACGACCCCGTCTGGG + Intergenic
924824055 1:247521789-247521811 GCCTGGCCACCACCCCGTCTGGG + Intronic
1063084740 10:2806487-2806509 GCCCGGCCACGACCCCGTCTGGG - Intergenic
1063822633 10:9855523-9855545 GCCTGGCCGCCACCCCGTCTGGG - Intergenic
1064109137 10:12523139-12523161 GCCCAGCCGCGACCCCGTCTGGG - Intronic
1064234917 10:13564998-13565020 GACTTTCCCCCACTCCTTCTGGG + Intergenic
1065594439 10:27296808-27296830 GCCCGGCCACGACCCCGTCTGGG - Intergenic
1065738029 10:28771817-28771839 GTCTGGCCGCGACCCCGTCTGGG + Intergenic
1066085852 10:31971086-31971108 GCCCGGCCACGACCCCGTCTGGG + Intergenic
1066140541 10:32500401-32500423 GCCTGGCCGTGACCCCGTCTGGG - Intronic
1066390887 10:34976597-34976619 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1066693558 10:38057806-38057828 GCCTTTCCAGGGCCCTGTCTTGG - Exonic
1066818753 10:39456127-39456149 GCCTGGCCACCACCCCGTCTGGG - Intergenic
1067034077 10:42900194-42900216 GCCCTGCCGCCACCCCGTCTGGG + Intergenic
1067100201 10:43329324-43329346 GCCTGGCCGCCACCCCGTCTGGG + Intergenic
1067120096 10:43465502-43465524 GCCCGGCCACGACCCCGTCTGGG - Intronic
1067354451 10:45512122-45512144 GCCCAGCCGCGACCCCGTCTGGG + Intronic
1067391267 10:45865718-45865740 GCCTGGCCGCGACCCCGTCTGGG - Intergenic
1067872021 10:49970434-49970456 GCCTGGCCGCGACCCCGTCTGGG + Intronic
1067912057 10:50355875-50355897 GCCCAGCCGCGACCCCGTCTGGG + Intronic
1068673218 10:59744304-59744326 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1069052726 10:63811778-63811800 GCCTGGCCGCGACCCCATCTGGG - Intergenic
1069365558 10:67691301-67691323 GCCTGGCCACCACCCCGTCTGGG + Intronic
1069645262 10:69992600-69992622 GCCCGGCCACGACCCCGTCTGGG - Intergenic
1070367385 10:75750392-75750414 GCCTGACCGCCACCCCGTCTGGG - Intronic
1070367394 10:75750432-75750454 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1070629705 10:78076058-78076080 GCCCAGCCGCGACCCCGTCTGGG - Intergenic
1070751720 10:78967888-78967910 GCCTGTCCCTCACCCTGTCTGGG - Intergenic
1070807550 10:79279318-79279340 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1071289758 10:84180441-84180463 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1071311316 10:84347299-84347321 GCCTGGCCACCACCCCGTCTAGG - Intronic
1071311507 10:84347807-84347829 GCCCAGCCACGACCCCGTCTGGG - Intronic
1071538281 10:86454837-86454859 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1071616435 10:87080619-87080641 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1072013477 10:91323604-91323626 GCCCAGCCGCGACCCCGTCTGGG - Intergenic
1072481137 10:95810206-95810228 GCCTGGCCACCACCCCGTCTGGG - Intronic
1072481149 10:95810246-95810268 GCCTGGCCGCCACCCCGTCTGGG - Intronic
1072602069 10:96940838-96940860 GCCCGGCCACGACCCCGTCTGGG - Intronic
1072772383 10:98152671-98152693 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1072956454 10:99891854-99891876 GCCCGGCCACGACCCCGTCTGGG + Intronic
1072999595 10:100276912-100276934 GCCTGGCCGCCACCCCGTCTGGG + Intronic
1073274882 10:102301619-102301641 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1074588208 10:114787801-114787823 GCCCGGCCACGACCCCGTCTGGG + Intergenic
1075657991 10:124174444-124174466 GCCTTTCTCTGACCCCCTTTGGG - Intergenic
1075841800 10:125511240-125511262 GCCCCTCCCCGCCCCCGTCGCGG + Intergenic
1075842759 10:125518410-125518432 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1076011790 10:126995035-126995057 GCCCAGCCACGACCCCGTCTGGG - Intronic
1076506127 10:130973656-130973678 GGCTTTCCCTGCCCCCGTCAGGG - Intergenic
1076878713 10:133229935-133229957 GCCTACCCCCGCCCCCGTCGAGG - Intergenic
1076914365 10:133414518-133414540 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1077610964 11:3642796-3642818 GCCTTTCCCCCACCTCCTCTGGG + Intergenic
1077668458 11:4137292-4137314 GCCTGGCCACCACCCCGTCTGGG - Intronic
1078177234 11:8978995-8979017 GCCCGGCCACGACCCCGTCTGGG + Intergenic
1078524463 11:12090083-12090105 GCCTTTCCCCAGCCCAATCTGGG + Intergenic
1079445051 11:20549083-20549105 GCCCGGCCACGACCCCGTCTGGG + Intergenic
1079479316 11:20863499-20863521 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1080620953 11:33986472-33986494 GCCTGGCCACCACCCCGTCTGGG + Intergenic
1080983223 11:37431760-37431782 GCCTGGCCACCACCCCGTCTGGG - Intergenic
1082233782 11:49798560-49798582 GCCTGGCCGCAACCCCGTCTGGG - Intergenic
1082233840 11:49798792-49798814 GCCTGGCCGCCACCCCGTCTGGG - Intergenic
1082706159 11:56497078-56497100 GCTTGGCCGCGACCCCGTCTGGG + Intergenic
1082844822 11:57717017-57717039 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1082871030 11:57943988-57944010 GCCCGGCCTCGACCCCGTCTGGG - Intergenic
1083030214 11:59585317-59585339 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1083036777 11:59645303-59645325 GCCCTGCCACCACCCCGTCTGGG - Intronic
1083042257 11:59699728-59699750 GCCCAGCCGCGACCCCGTCTGGG + Intergenic
1083091249 11:60201465-60201487 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1083114953 11:60451365-60451387 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1083208289 11:61166569-61166591 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1083583251 11:63838833-63838855 GCCTTTCCCCGCCCACTTCAAGG - Intergenic
1083831954 11:65239027-65239049 GCCTGGCCACCACCCCGTCTGGG + Intergenic
1083832015 11:65239299-65239321 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1084022557 11:66426338-66426360 GCCTTTCCCCCACCAAGGCTAGG - Exonic
1084048887 11:66587667-66587689 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1084388780 11:68861531-68861553 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1084924844 11:72502856-72502878 GCCCAGCCGCGACCCCGTCTGGG - Intergenic
1085073708 11:73571933-73571955 GCCCAGCCACGACCCCGTCTGGG + Intronic
1085097776 11:73775062-73775084 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1085116746 11:73936987-73937009 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1085139717 11:74129389-74129411 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1085159637 11:74328448-74328470 GCCTGACCGCCACCCCGTCTGGG + Intergenic
1085292286 11:75409708-75409730 GCCCGGCCACGACCCCGTCTGGG - Intronic
1085443286 11:76582427-76582449 GCCTGGCCGCCACCCCGTCTGGG - Intergenic
1085791294 11:79499896-79499918 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1086341481 11:85852899-85852921 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1086365979 11:86110348-86110370 GCCTGGCCACCACCCCGTCTGGG + Intergenic
1086434866 11:86770859-86770881 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1087214657 11:95482227-95482249 GCCCTGCCGCCACCCCGTCTGGG + Intergenic
1088116315 11:106317617-106317639 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1088257096 11:107912485-107912507 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1089148435 11:116347068-116347090 GCCCATCCGCGACCCTGTCTGGG + Intergenic
1089421159 11:118332077-118332099 GCCCGGCCACGACCCCGTCTGGG - Intergenic
1089585740 11:119508469-119508491 GCCTGGCCACCACCCCGTCTGGG - Intergenic
1090322872 11:125862889-125862911 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1090686593 11:129128992-129129014 GCCTGGCCGCCACCCCGTCTGGG + Intronic
1090686625 11:129129108-129129130 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1090906814 11:131084166-131084188 GCCCGGCCACGACCCCGTCTGGG - Intergenic
1091378864 12:42774-42796 GCCCGGCCACGACCCCGTCTGGG + Intergenic
1092185537 12:6475808-6475830 GCCTGGCCGTGACCCCGTCTAGG - Intergenic
1092295877 12:7199727-7199749 GCCTGGCCACCACCCCGTCTGGG - Intronic
1092296068 12:7200204-7200226 GCCTGGCCGCGACCCCGTCTGGG - Intronic
1092402038 12:8184823-8184845 GCCTGGCCACCACCCCGTCTGGG + Intronic
1092454012 12:8626241-8626263 GCCCGGCCACGACCCCGTCTGGG + Intergenic
1092843904 12:12566379-12566401 GCCTGGCCACCACCCCGTCTGGG + Intergenic
1093038485 12:14354714-14354736 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1093038589 12:14354997-14355019 GCCTGGCCGCCACCCCGTCTGGG + Intergenic
1094239089 12:28201342-28201364 ACCTGGCCGCGACCCCGTCTGGG - Intronic
1094324418 12:29221258-29221280 GCCTTTCCCTGATGCCGACTAGG + Intronic
1094670381 12:32563315-32563337 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1094716998 12:33023022-33023044 GCCCGGCCACGACCCCGTCTGGG - Intergenic
1095068461 12:37814233-37814255 GCCTGGCCACCACCCCGTCTGGG - Intergenic
1095439432 12:42227520-42227542 GCCCTGCCGAGACCCCGTCTGGG + Intronic
1096224877 12:49860638-49860660 GCCTGGCCGCCACCCCGTCTGGG + Intergenic
1096224942 12:49860910-49860932 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1096951654 12:55479391-55479413 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1096968619 12:55648275-55648297 GCCCTGCCGCCACCCCGTCTGGG - Intergenic
1096968695 12:55648513-55648535 GCCAGGCCTCGACCCCGTCTGGG - Intergenic
1097110097 12:56651896-56651918 GCCTGACCGCCACCCCGTCTGGG - Intergenic
1097110106 12:56651936-56651958 GCCCGGCCACGACCCCGTCTGGG - Intergenic
1097127141 12:56783991-56784013 GCCCAGCCGCGACCCCGTCTGGG - Intronic
1097128205 12:56790139-56790161 GCCTGGCCGCCACCCCGTCTGGG - Intergenic
1097228649 12:57495355-57495377 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1097230334 12:57507374-57507396 GCCTGGCCACCACCCCGTCTGGG - Intronic
1097254751 12:57665072-57665094 GCCTGGCCGCCACCCCGTCTAGG + Intergenic
1097254875 12:57665532-57665554 GCCTGGCCACCACCCCGTCTAGG + Intergenic
1097779525 12:63686799-63686821 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1097895980 12:64825096-64825118 GCCTTAGCCTGACTCCGTCTAGG + Intronic
1098379506 12:69853469-69853491 GCCTGGCCGCGACTCCGTCTGGG - Intronic
1098413174 12:70203233-70203255 GCCCGGCCACGACCCCGTCTGGG + Intergenic
1099971297 12:89503680-89503702 GCCCTGCTGCGACCCCGTCTGGG + Intronic
1100003635 12:89867619-89867641 GCCCAGCCACGACCCCGTCTGGG - Intergenic
1100048198 12:90411095-90411117 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1100570236 12:95840362-95840384 GCCCGGCCACGACCCCGTCTGGG - Intergenic
1100995283 12:100295012-100295034 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1101164099 12:102010242-102010264 TCCTTCCCCCTACCCCATCTGGG - Intronic
1102186383 12:110951170-110951192 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1102268264 12:111507305-111507327 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1102656310 12:114485008-114485030 GCCCCGCCACGACCCCGTCTGGG - Intergenic
1103045365 12:117731149-117731171 GCCCGGCCACGACCCCGTCTGGG + Intronic
1103350211 12:120278486-120278508 GCCCTGCCGCCACCCCGTCTGGG - Intergenic
1103414106 12:120732576-120732598 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1105267881 13:18837540-18837562 GCCTGGCCGCCACCCCGTCTGGG - Intergenic
1105368178 13:19780283-19780305 GCCTGGCCACCACCCCGTCTGGG + Intronic
1105976847 13:25480470-25480492 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1106104735 13:26723828-26723850 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1107588755 13:41881586-41881608 GCCTGGCCACCACCCCGTCTGGG - Intronic
1107589005 13:41882390-41882412 GCCTGGCCGCCACCCCGTCTGGG - Intronic
1107863544 13:44682713-44682735 GCCTGGCCGCGACCCCGTCTGGG - Intergenic
1108024374 13:46162825-46162847 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1108348111 13:49565619-49565641 GCCCAGCCCCGACCCCGTCTGGG + Intronic
1108608513 13:52063714-52063736 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1110506640 13:76295098-76295120 GCCTGGCCGCCACCCCGTCTAGG + Intergenic
1110506695 13:76295291-76295313 GCCCTGCGGCGACCCCGTCTGGG + Intergenic
1111388567 13:87561655-87561677 GCCCAGCCGCGACCCCGTCTGGG + Intergenic
1112070574 13:95845771-95845793 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1112070639 13:95846011-95846033 GCCTGGCCGCCACCCCGTCTAGG - Intronic
1112077307 13:95928549-95928571 GCCCCGCCGCGACCCCGTCTGGG - Intronic
1113329202 13:109311856-109311878 GCCCTACCGCCACCCCGTCTGGG + Intergenic
1113735826 13:112678589-112678611 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1114199007 14:20505723-20505745 GCCTGGCCGCCACCCCGTCTGGG + Intronic
1114280474 14:21188860-21188882 GCCCGGCCGCGACCCCGTCTAGG + Intergenic
1114336636 14:21697814-21697836 GCCGTGCAGCGACCCCGTCTGGG + Intergenic
1114336643 14:21697854-21697876 GCCCTGCCGCCACCCCGTCTGGG + Intergenic
1114428055 14:22638124-22638146 GCCCGGCCACGACCCCGTCTGGG + Intergenic
1114491961 14:23108292-23108314 GCCCGTCCGCCACCCCGTCTGGG - Intergenic
1114578768 14:23737019-23737041 GCCTGGCCGCCACCCCGTCTAGG + Intergenic
1115504250 14:34078918-34078940 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1115547427 14:34476102-34476124 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1115688987 14:35824942-35824964 GCCCAGCCGCGACCCCGTCTGGG - Intergenic
1115703243 14:35976667-35976689 GCCCGGCCACGACCCCGTCTGGG - Intergenic
1116005406 14:39285836-39285858 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1116192139 14:41675189-41675211 GCCTGGCCGCCACCCCGTCTGGG - Intronic
1116409081 14:44601381-44601403 GCCCTGCCGCGACCCCGTCTGGG + Intergenic
1116841037 14:49821066-49821088 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1116959683 14:50956701-50956723 GCCCCGCCACGACCCCGTCTGGG - Intergenic
1117010601 14:51467488-51467510 GCCTGGCCGCTACCCCGTCTGGG - Intergenic
1118148569 14:63165518-63165540 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1118184134 14:63522625-63522647 ACCCGTCCGCGACCCCGTCTGGG + Intronic
1118184145 14:63522665-63522687 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1118340732 14:64894666-64894688 GCCCGGCCACGACCCCGTCTGGG - Intergenic
1118423456 14:65633428-65633450 GCCTGGCCGCCACCCCGTCTGGG + Intronic
1118423514 14:65633661-65633683 GCCCGGCCACGACCCCGTCTGGG + Intronic
1118428714 14:65693093-65693115 GCCTGGCCGCCACCCCGTCTGGG - Intronic
1118627784 14:67674796-67674818 GCCTTTCCCCAACCCGGACCCGG - Exonic
1118955509 14:70477375-70477397 GCCTGGCCGCCACCCCGTCTGGG + Intergenic
1119051874 14:71377370-71377392 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1119254617 14:73184920-73184942 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1119868557 14:77993877-77993899 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1120193807 14:81462610-81462632 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1120406682 14:84100002-84100024 GCCTGGCCGCCACCCCGTCTGGG - Intergenic
1121323434 14:93006227-93006249 GCGTTTCCCCTACCCCTTGTTGG - Intronic
1121531557 14:94658065-94658087 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1122568035 14:102676233-102676255 GCCCGGCCACGACCCCGTCTGGG - Intronic
1122941631 14:104984120-104984142 GCAATTCCCCACCCCCGTCTGGG - Intergenic
1122957785 14:105079365-105079387 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1202917590 14_GL000194v1_random:190700-190722 GCCCGGCCACGACCCCGTCTGGG + Intergenic
1123429723 15:20204135-20204157 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1124163436 15:27295714-27295736 GACTTTACCAGACCCCCTCTGGG - Intronic
1124334921 15:28849460-28849482 GCCTGGCCGCCACCCCGTCTGGG - Intergenic
1124484823 15:30104368-30104390 GCCTTTCCCCTTCCCCGCCTGGG - Intergenic
1124518757 15:30392870-30392892 GCCTTTCCCCTTCCCCGCCTGGG + Intronic
1124539899 15:30573376-30573398 GCCTTTCCCCTTCCCCGCCTGGG - Intergenic
1124607855 15:31184607-31184629 GCCCCGCCGCGACCCCGTCTGGG + Intergenic
1124758752 15:32434206-32434228 GCCTTTCCCCTTCCCCGCCTGGG + Intergenic
1124973596 15:34514275-34514297 GTCTTTCCCCTTCCCCGCCTGGG + Intergenic
1125519330 15:40339443-40339465 GTCTTTCCCCGACATGGTCTGGG + Intronic
1125861519 15:43005019-43005041 GCCCAGCCGCGACCCCGTCTGGG + Intronic
1125862773 15:43014560-43014582 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1125868643 15:43077123-43077145 GCCCGGCCACGACCCCGTCTGGG + Intronic
1126816551 15:52460001-52460023 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1127088737 15:55446903-55446925 GCCTGGCCGCCACCCCGTCTGGG - Intronic
1127584768 15:60367783-60367805 GCCTGGCCACGACCCCGTCTGGG + Intronic
1127644647 15:60946909-60946931 GCCCGGCCCCGACCCCGTCTGGG + Intronic
1127782995 15:62332605-62332627 GCCGGGCCGCGACCCCGTCTGGG - Intergenic
1127824372 15:62690324-62690346 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1127874216 15:63098684-63098706 GCCTGGCCGCCACCCCGTCTGGG + Intergenic
1127874281 15:63098956-63098978 GCCCTGCCGTGACCCCGTCTGGG + Intergenic
1128071388 15:64799359-64799381 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1128500230 15:68222279-68222301 GCCTGGCCGCCACCCCGTCTAGG + Intronic
1128731677 15:70025585-70025607 GCCCTTCCCAGACACCCTCTTGG - Intergenic
1128970114 15:72100641-72100663 GCCCCGCCACGACCCCGTCTGGG + Intronic
1129008714 15:72396536-72396558 GCCTGGCCGCGACCCTGTCTGGG + Intergenic
1129054176 15:72807385-72807407 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1130508562 15:84570190-84570212 GCCTTTCCCCTTCCCCGCCCGGG + Intergenic
1131141229 15:89978223-89978245 GCCTGGCCACCACCCCGTCTGGG + Intergenic
1131479400 15:92768634-92768656 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1131713302 15:95079742-95079764 GCCTTTCCACAACCTCGTGTGGG - Intergenic
1133299663 16:4774877-4774899 GCCTGGCCACCACCCCGTCTGGG - Intergenic
1133364733 16:5202270-5202292 GCCCGGCCACGACCCCGTCTGGG - Intergenic
1134750175 16:16619196-16619218 GCCCAGCCGCGACCCCGTCTGGG - Intergenic
1134995285 16:18734402-18734424 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1136155142 16:28377333-28377355 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1136165140 16:28448587-28448609 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1136197824 16:28666393-28666415 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1136207969 16:28738006-28738028 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1136214172 16:28780570-28780592 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1136425719 16:30168773-30168795 GCCCGGCCACGACCCCGTCTGGG + Intergenic
1136723241 16:32340008-32340030 GCCCTGCCCTGACCCCGCCTTGG - Intergenic
1136773713 16:32860397-32860419 GCCCTGCCCTGACCCCGCCTTGG + Intergenic
1136841562 16:33546012-33546034 GCCCTGCCCTGACCCCGCCTTGG - Intergenic
1136896899 16:34001122-34001144 GCCCTGCCCTGACCCCGCCTTGG - Intergenic
1137439107 16:48483317-48483339 GCCCGGCCACGACCCCGTCTGGG - Intergenic
1137493460 16:48951777-48951799 GCCCGGCCCCGACCCCGTCTGGG + Intergenic
1137523107 16:49210789-49210811 GCCTGGCCGCTACCCCGTCTGGG - Intergenic
1139394720 16:66630939-66630961 GCCTGGCCGCGACCCCATCTGGG + Intronic
1139623247 16:68163716-68163738 GCCCAGCCGCGACCCCGTCTGGG - Intronic
1139864749 16:70052420-70052442 GCCCGGCCACGACCCCGTCTGGG + Intergenic
1139885732 16:70205425-70205447 GCCTGGCCACCACCCCGTCTGGG + Intergenic
1140161242 16:72496992-72497014 GCCCGGCCACGACCCCGTCTGGG + Intergenic
1140862372 16:79029207-79029229 ACCTTTGCCCCACCCCGTCACGG + Intronic
1141728766 16:85808329-85808351 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1203003191 16_KI270728v1_random:177757-177779 GCCCTGCCCTGACCCCGCCTTGG + Intergenic
1203076131 16_KI270728v1_random:1122508-1122530 GCCCTGCCCTGACCCCGCCTTGG + Intergenic
1203134797 16_KI270728v1_random:1714163-1714185 GCCCTGCCCTGACCCCGCCTTGG + Intergenic
1142529845 17:572224-572246 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1142683143 17:1562101-1562123 TCCCTGCCCTGACCCCGTCTCGG + Intronic
1142705301 17:1690010-1690032 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1142818924 17:2448215-2448237 GCCCGGCCACGACCCCGTCTGGG + Intronic
1142939532 17:3371139-3371161 GCCTGGCCACCACCCCGTCTGGG - Intergenic
1142949187 17:3464661-3464683 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1142963247 17:3564442-3564464 GCCCGGCCACGACCCCGTCTGGG - Intergenic
1143342750 17:6226269-6226291 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1143689631 17:8550369-8550391 GCCCGGCCCCGACCCCGTCTGGG + Intronic
1143884772 17:10057435-10057457 GCCGGGCCGCGACCCCGTCTGGG + Intronic
1144369593 17:14577331-14577353 GCCCTTCCCTCACCCCCTCTAGG - Intergenic
1144536350 17:16095246-16095268 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1144541308 17:16145500-16145522 GCCCGGCCACGACCCCGTCTGGG + Intronic
1144866293 17:18337981-18338003 GCCTGGCCGCCACCCCGTCTGGG + Intronic
1145087021 17:19950950-19950972 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1145158334 17:20557376-20557398 GCCCAGCCGCGACCCCGTCTGGG + Intergenic
1145418023 17:22740918-22740940 GCCTGGCCGCCACCCCGTCTGGG + Intergenic
1145717341 17:27034297-27034319 GCCTGGCCACCACCCCGTCTGGG + Intergenic
1145733889 17:27212782-27212804 GCCCGGCCACGACCCCGTCTGGG + Intergenic
1145896111 17:28458864-28458886 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1145927517 17:28659201-28659223 GCCTGGCCGCCACCCCGTCTGGG - Intronic
1146155838 17:30523337-30523359 GCCCGGCCGCGACCCCGTCTGGG + Exonic
1146215811 17:30979130-30979152 GCCCGGCCACGACCCCGTCTGGG - Intronic
1146371138 17:32266165-32266187 GCCGCCCCCGGACCCCGTCTCGG + Exonic
1146443974 17:32921803-32921825 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1146731324 17:35195365-35195387 GCCTGGCCGCGACCCCATCTGGG - Intergenic
1147277864 17:39333786-39333808 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1147278380 17:39337587-39337609 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1147558204 17:41493020-41493042 GCCTTTCCCCACGCCCATCTTGG + Intergenic
1147670926 17:42176345-42176367 GCCTTTCCCACCCCCCATCTTGG - Intronic
1147785035 17:42973003-42973025 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1147785207 17:42973465-42973487 GCCTGGCCACCACCCCGTCTGGG + Intronic
1147809733 17:43159586-43159608 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1147852027 17:43450991-43451013 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1147974141 17:44238054-44238076 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1148016229 17:44524434-44524456 GCCTGGCCGCCACCCCGTCTGGG + Intergenic
1148636128 17:49150394-49150416 GCCTGGCCACCACCCCGTCTGGG + Intronic
1149780656 17:59394327-59394349 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1149908816 17:60551195-60551217 GCCCTGCCGAGACCCCGTCTGGG + Intergenic
1150248949 17:63695606-63695628 GCCTCTCTACGACCCCATCTTGG + Exonic
1150402932 17:64874288-64874310 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1150675585 17:67244570-67244592 CCCTTTCCCCGCCCCCTCCTCGG - Intronic
1150894658 17:69196365-69196387 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1151665453 17:75542933-75542955 GCCTCTCCCCTGCCCCGACTTGG + Intronic
1152020392 17:77777115-77777137 GCCCGGCCACGACCCCGTCTGGG + Intergenic
1152069889 17:78129151-78129173 GACTCTCCCCGACCCCGGCGGGG + Intronic
1152231439 17:79115858-79115880 GCCTTTCCCCGGCCCCTCCAAGG + Intronic
1152458544 17:80429686-80429708 GCAGTTCCCAGACCCCATCTGGG + Intronic
1152479006 17:80537615-80537637 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1152592193 17:81219108-81219130 GCCTTTCACAGCCCCCATCTGGG + Intronic
1152672670 17:81618338-81618360 GCCTGGCCGCGACCCCGTCTGGG + Intronic
1154089593 18:11344678-11344700 GCCTGGCCACAACCCCGTCTGGG + Intergenic
1154158271 18:11960138-11960160 GCCTGGCCACCACCCCGTCTGGG + Intergenic
1154265064 18:12873697-12873719 GCCTGGCCGCCACCCCGTCTAGG + Intronic
1154289869 18:13098167-13098189 GCCTGGCCACCACCCCGTCTGGG - Intronic
1156577463 18:38334630-38334652 GTCTTTCCCCTACACCCTCTAGG + Intergenic
1159340474 18:67126991-67127013 GCCCGGCCCCGACCCTGTCTGGG - Intergenic
1159652825 18:70997708-70997730 TCCTTTCCCCCACCCTGCCTGGG - Intergenic
1160916618 19:1499603-1499625 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1161685731 19:5701932-5701954 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1162278944 19:9680022-9680044 GCCCAGCCGCGACCCCGTCTGGG + Intergenic
1162538213 19:11276843-11276865 GCCTGGCCGCGACCCCGTCTGGG - Intergenic
1162602023 19:11676781-11676803 GCCTGGCCTCCACCCCGTCTGGG - Intergenic
1162695041 19:12467782-12467804 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1162798292 19:13097856-13097878 TCCTATCCCCGACCCCCTCCGGG + Intronic
1163144921 19:15373677-15373699 GCCTGTCCCCGCCTCCCTCTTGG - Intronic
1163558537 19:18005941-18005963 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1163865518 19:19770133-19770155 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1163909444 19:20176140-20176162 GCCCAGCCGCGACCCCGTCTGGG - Intronic
1163921759 19:20296482-20296504 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1163945536 19:20530582-20530604 GCCCGGCCACGACCCCGTCTGGG - Intergenic
1164012070 19:21212475-21212497 GCCTGGCCACCACCCCGTCTGGG - Intergenic
1164012172 19:21212795-21212817 GCCTGACCGCGACCCCATCTGGG - Intergenic
1164040253 19:21487168-21487190 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1164047041 19:21551600-21551622 GCCCGGCCACGACCCCGTCTGGG - Intronic
1164066881 19:21722184-21722206 GCCCGGCCACGACCCCGTCTGGG + Intergenic
1164071809 19:21775877-21775899 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1164168152 19:22700643-22700665 GCCCAGCCGCGACCCCGTCTGGG - Intergenic
1164168581 19:22703248-22703270 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1164192935 19:22928058-22928080 GCCCGGCCACGACCCCGTCTGGG + Intergenic
1164214795 19:23134696-23134718 GCCCGGCCACGACCCCGTCTGGG + Intronic
1164218571 19:23172974-23172996 GCCTGGCCGCCACCCCGTCTGGG + Intergenic
1164244651 19:23419295-23419317 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1164659337 19:29949264-29949286 GCCCGGCCACGACCCCGTCTGGG - Intronic
1165311430 19:35031100-35031122 GCGTTTCCTCGCCCCCGGCTGGG - Intronic
1165540788 19:36491072-36491094 GCCTGGCCGCGACCCCGTCTGGG + Intergenic
1165540990 19:36491615-36491637 GCCTGGCCACGACCCCATCTGGG + Intergenic
1165727741 19:38124316-38124338 GCCTGGCCGCGACCCCGTCTGGG - Intronic
1165891741 19:39116687-39116709 GGGTTTCCACGACCCCCTCTTGG + Intergenic
1166162446 19:40965035-40965057 GCCCGGCCACGACCCCGTCTGGG - Intergenic
1166277984 19:41768622-41768644 GCCTGGCCACCACCCCGTCTGGG - Intronic
1166418066 19:42610625-42610647 GCCCCACCGCGACCCCGTCTGGG - Intronic
1166532015 19:43548246-43548268 GCCTGGCCACCACCCCGTCTGGG + Intronic
1166708422 19:44921830-44921852 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1167588749 19:50391091-50391113 GCCTGGCCGCCACCCCGTCTGGG - Intronic
1167699392 19:51033671-51033693 GCCATTCCTTGACCCAGTCTGGG - Intronic
1167907828 19:52676598-52676620 GCCTGGCCACCACCCCGTCTGGG + Intronic
1167924728 19:52812237-52812259 GCCCGGCCACGACCCCGTCTGGG + Intronic
1167937534 19:52920161-52920183 GCCCGGCCACGACCCCGTCTGGG + Intergenic
1167970489 19:53186471-53186493 GCCCGGCCACGACCCCGTCTGGG - Intronic
1167971150 19:53188169-53188191 GCCCGGCCCCCACCCCGTCTGGG - Intronic
1168658265 19:58147192-58147214 GCCCGGCCGCGACCCCGTCTGGG + Intronic
925400519 2:3569309-3569331 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
925730775 2:6918085-6918107 TCCTTTCCCAGACCTCCTCTTGG - Intronic
926136906 2:10342896-10342918 GCCTTCCCCCGGCCCCTTTTTGG + Intronic
926322695 2:11760034-11760056 GCCCGGCCGCGACCCCGTCTGGG - Intronic
926639456 2:15219847-15219869 GCCCGGCCACGACCCCGTCTGGG - Intronic
926667619 2:15542099-15542121 GCCTGGCCACCACCCCGTCTGGG + Intronic
926683369 2:15680350-15680372 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
927978700 2:27359436-27359458 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
928005073 2:27557235-27557257 GCCCGGCCACGACCCCGTCTGGG - Intronic
928005537 2:27558490-27558512 GCCTGGCCGCCACCCCGTCTGGG - Intronic
928395248 2:30938738-30938760 GCCCTTGCCCTACCCCATCTTGG - Intronic
928541933 2:32293613-32293635 GCCTGGCCACCACCCCGTCTGGG - Intronic
928557862 2:32447275-32447297 GCCCGGCCACGACCCCGTCTGGG - Intronic
928585439 2:32754667-32754689 GCCCGGCCACGACCCCGTCTGGG - Intronic
929238178 2:39628046-39628068 GCCTGGCCACCACCCCGTCTGGG - Intergenic
929447982 2:42015193-42015215 GCCTGGCCGCCACCCCGTCTGGG - Intergenic
929517947 2:42621808-42621830 GCCCGGCCACGACCCCGTCTGGG - Intronic
929577798 2:43063329-43063351 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
929650831 2:43678064-43678086 GCCCGGCCGCGACCCCGTCTGGG - Intronic
929690335 2:44067650-44067672 GCCTGGCCGCGACCCCGTCTGGG - Intergenic
929739991 2:44589356-44589378 GCCCGGCCACGACCCCGTCTGGG + Intronic
929776458 2:44933779-44933801 TCCCTGCCCCGACCCCGTCTGGG + Intergenic
930208849 2:48614787-48614809 GCCCGGCCGCGACCCCGTCTGGG - Intronic
930396406 2:50828543-50828565 GCCCGGCCGCGACCCCGTCTGGG - Intronic
930396473 2:50828815-50828837 GCCTGGCCGCCACCCCGTCTGGG - Intronic
930833986 2:55774056-55774078 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
931783811 2:65601428-65601450 GCCTGGCCACCACCCCGTCTGGG - Intergenic
932410303 2:71543215-71543237 GCCCGGCCGCGACCCCGTCTGGG - Intronic
934894527 2:98102512-98102534 GCCTGGCCGCCACCCCGTCTGGG - Intronic
934990948 2:98921168-98921190 GCCTTTGCCTGAGCACGTCTGGG - Intronic
934998430 2:98988701-98988723 GCCTGGCCACCACCCCGTCTGGG - Intergenic
934998588 2:98989121-98989143 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
936345629 2:111672831-111672853 GCCTGGCCGCGACCCCGGCTGGG + Intergenic
937437571 2:121892746-121892768 GCCTGGCCGCGACCCCGTCTGGG + Intergenic
938088599 2:128418100-128418122 GCCCGGCCACGACCCCGTCTGGG - Intergenic
938253349 2:129833429-129833451 GCCTGGCCGCCACCCCGTCTGGG + Intergenic
938720556 2:134063821-134063843 GCCTGGCCGCCACCCCGTCTGGG + Intergenic
938720619 2:134064053-134064075 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
938821980 2:134968664-134968686 GCCCGGCCGCGACCCCGTCTGGG - Intronic
938836313 2:135106229-135106251 GCCTGGCCGCCACCCCGTCTGGG + Intronic
940635561 2:156293543-156293565 GCCCGGCCCCAACCCCGTCTAGG + Intergenic
940643798 2:156369598-156369620 GCCCGGCCACGACCCCGTCTGGG + Intergenic
940652446 2:156451908-156451930 GCCCGGCCGCGACCCCGTCTGGG - Intronic
940817267 2:158310636-158310658 GCCTGGCCACGACCCCGTCTGGG - Intronic
941793384 2:169575560-169575582 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
941822287 2:169855870-169855892 GCCTGGCCGCCACCCCGTCTGGG - Intronic
941822393 2:169856187-169856209 GCCCGGCCGCGACCCCGTCTGGG - Intronic
942021059 2:171866987-171867009 GCCCAGCCGCGACCCCGTCTGGG - Intronic
942024674 2:171899920-171899942 GCCCGGCCGCGACCCCGTCTGGG + Intronic
942096142 2:172537852-172537874 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
942112931 2:172700395-172700417 GCCTGGCCACGACCCCGTCTGGG - Intergenic
942355609 2:175108171-175108193 GCCCGGCCGCGACCCCGTCTGGG + Intronic
943100306 2:183479151-183479173 GCCTGGCTGCGACCCCGTCTGGG + Intergenic
943297219 2:186154325-186154347 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
943297283 2:186154597-186154619 GCCTGGCCGCCACCCCGTCTGGG - Intergenic
943648244 2:190430728-190430750 GCCTGGCCACCACCCCGTCTGGG - Intronic
943648346 2:190431019-190431041 GCCCGGCCGCGACCCCGTCTGGG - Intronic
943739716 2:191397715-191397737 GCCCGGCCACGACCCCGTCTGGG - Intronic
943863176 2:192894133-192894155 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
944263171 2:197696725-197696747 GCCCGGCCGCGACCCCGTCTGGG - Intronic
944570790 2:201042481-201042503 GCCCCGCCGCGACCCCGTCTGGG + Intronic
944598283 2:201282459-201282481 GCCCGGCCACGACCCCGTCTGGG - Intronic
944722690 2:202440281-202440303 GCCCTACCACCACCCCGTCTGGG - Intronic
944722699 2:202440321-202440343 GCCCGGCCGCGACCCCGTCTGGG - Intronic
944815618 2:203372824-203372846 GCCCAGCCGCGACCCCGTCTGGG - Intronic
945039311 2:205730818-205730840 GCCTTGCCTCAGCCCCGTCTGGG - Intronic
945090394 2:206171914-206171936 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
945232856 2:207610204-207610226 GCCTGGCCGCCACCCCGTCTGGG + Exonic
945233323 2:207611491-207611513 GCCCGGCCACGACCCCGTCTGGG + Exonic
945316692 2:208377727-208377749 GCCCAGCCGCGACCCCGTCTGGG - Intronic
945316747 2:208377959-208377981 GCCTGGCCGCCACCCCGTCTGGG - Intronic
945835504 2:214834820-214834842 GCCCGGCCACGACCCCGTCTGGG - Intergenic
945970020 2:216225764-216225786 GCCCGGCCACGACCCCGTCTGGG - Intergenic
946750963 2:222896002-222896024 GCCCGGCCACGACCCCGTCTGGG - Intronic
947402253 2:229742588-229742610 GCCTGGCCGCCACCCCGTCTGGG + Intergenic
947797712 2:232905511-232905533 GCCGGTCCGCCACCCCGTCTGGG + Intronic
948000359 2:234562575-234562597 GCCGGTCCGCCACCCCGTCTGGG + Intergenic
948000502 2:234563086-234563108 GCCCGGCCACGACCCCGTCTGGG + Intergenic
948651744 2:239449964-239449986 GCCGGTCCGCCACCCCGTCTGGG - Intergenic
1169086227 20:2825213-2825235 GCCCGGCCACGACCCCGTCTGGG + Intergenic
1169125830 20:3125868-3125890 GCCTGGCCGCCACCCCGTCTGGG + Intronic
1169247267 20:4033546-4033568 GCCCGGCCACGACCCCGTCTGGG + Intergenic
1169441825 20:5639472-5639494 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1169449853 20:5701993-5702015 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1169718257 20:8644476-8644498 GCCCAGCCGCGACCCCGTCTGGG + Intronic
1169885652 20:10395133-10395155 GCCCAGCCGCGACCCCGTCTGGG - Intergenic
1169991947 20:11513581-11513603 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1170188954 20:13625572-13625594 CCCTGTCCCCGACACCTTCTGGG - Intronic
1170202490 20:13760436-13760458 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1170592159 20:17779141-17779163 GCCTGGCCGCGACCCCGTCTGGG + Intergenic
1170623172 20:18010829-18010851 GCCAGGCCGCGACCCCGTCTGGG - Intronic
1170645663 20:18194471-18194493 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1170645675 20:18194511-18194533 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1170664593 20:18375765-18375787 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1170811662 20:19678857-19678879 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1171463634 20:25312820-25312842 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1171496802 20:25561714-25561736 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1171846746 20:30281938-30281960 GCTTTTCCCGGACTCCGCCTGGG - Intergenic
1171848575 20:30292238-30292260 GCCTGGCCGCCACCCCGTCTGGG - Intergenic
1171951605 20:31426981-31427003 GCCAGGCCGCGACCCCGTCTGGG + Intergenic
1172209241 20:33185509-33185531 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1172237687 20:33389265-33389287 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1172279860 20:33701178-33701200 GCCTGGCCGCCACCCCGTCTGGG + Intergenic
1172279920 20:33701410-33701432 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1172379273 20:34474970-34474992 GCCCAGCCGCGACCCCGTCTGGG - Intronic
1172739017 20:37151047-37151069 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1172918664 20:38462127-38462149 GCCTGGCCGCTACCCCGTCTGGG - Intergenic
1173272927 20:41554903-41554925 GCCTGGCCACCACCCCGTCTGGG - Intronic
1173508472 20:43607484-43607506 GCCCGGCCACGACCCCGTCTGGG - Intronic
1173673012 20:44810750-44810772 GGCTGTTCCCGACCCCGCCTCGG + Intergenic
1174878220 20:54250280-54250302 GCCCGGCCACGACCCCGTCTGGG - Intergenic
1175361123 20:58413668-58413690 GCCTGGCCACCACCCCGTCTGGG - Intronic
1175361474 20:58414539-58414561 GCCCGGCCACGACCCCGTCTGGG - Intronic
1175775855 20:61653459-61653481 GCCCGGCCACGACCCCGTCTGGG - Intronic
1176235023 20:64049962-64049984 GCCGTTCCCCGCCCCCCGCTGGG + Intronic
1176348154 21:5770329-5770351 GCCCTGCCACCACCCCGTCTGGG - Intergenic
1176354968 21:5890913-5890935 GCCCTGCCACCACCCCGTCTGGG - Intergenic
1176496673 21:7554126-7554148 GCCCTGCCACCACCCCGTCTGGG + Intergenic
1176542475 21:8168399-8168421 GCCCTGCCACCACCCCGTCTGGG - Intergenic
1176561426 21:8351444-8351466 GCCCTGCCACCACCCCGTCTGGG - Intergenic
1176695423 21:9971945-9971967 GCATTTCCCTGACCCCTTCATGG + Intergenic
1177788335 21:25695782-25695804 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1177788384 21:25695974-25695996 GCCTGGCCGCCACCCCGTCTGGG - Intronic
1179646406 21:42778696-42778718 GCCCGGCCACGACCCCGTCTGGG + Intergenic
1179969144 21:44824763-44824785 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1180039462 21:45268664-45268686 GCCTGGCCACGACCCCGTCTGGG + Intronic
1180110171 21:45643794-45643816 GCCTCGCCCCGACCCCGCCCGGG + Exonic
1180672078 22:17561260-17561282 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1180861253 22:19084361-19084383 GCCCGGCCACGACCCCGTCTGGG + Intronic
1181355048 22:22292350-22292372 GCCCTGCCCTGACCCCGCCTTGG - Intergenic
1181374056 22:22441798-22441820 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1181374167 22:22442092-22442114 GCCTGGCCACCACCCCGTCTGGG + Intergenic
1181586607 22:23855755-23855777 GCCCGGCCACGACCCCGTCTGGG + Intergenic
1181617582 22:24065320-24065342 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1181977035 22:26737541-26737563 GCCTTTGCCCAACCCCGGTTGGG + Intergenic
1182199478 22:28553845-28553867 GCCTGGCCACCACCCCGTCTGGG + Intronic
1182331222 22:29552712-29552734 GCCTGGCCGCCACCCCGTCTGGG + Intronic
1182399786 22:30066700-30066722 GCCTGGCTGCGACCCCGTCTGGG + Intergenic
1182451346 22:30423650-30423672 GCCAGGCCCCGGCCCCGTCTGGG + Exonic
1182539211 22:31027821-31027843 GCCCGGCCACGACCCCGTCTGGG + Intergenic
1182564036 22:31184270-31184292 GCCAGGCCGCGACCCCGTCTGGG - Intronic
1183434719 22:37786868-37786890 GCCCGGCCACGACCCCGTCTGGG + Intergenic
1183537246 22:38410168-38410190 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1183871336 22:40744676-40744698 GCCCGGCCACGACCCCGTCTGGG - Intergenic
1184115352 22:42418807-42418829 GTCTTTCCCTGACCCAGACTTGG + Intronic
1184120305 22:42445704-42445726 ACGTCTCCCCCACCCCGTCTTGG - Intergenic
1184203063 22:42982346-42982368 GCCCGGCCACGACCCCGTCTGGG + Intronic
1184766818 22:46576661-46576683 GCCTTTCCTCGACCGCCTCGCGG - Intronic
1185394225 22:50578499-50578521 GTTTTTCCCCGACCCCGATTTGG - Intronic
1203247414 22_KI270733v1_random:84817-84839 GCCCTGCCACCACCCCGTCTGGG - Intergenic
949565701 3:5242973-5242995 GCCCTGCCGCGACCCCGTCTGGG - Intergenic
949853366 3:8439976-8439998 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
950044308 3:9940098-9940120 GCCCGGCCGCGACCCCGTCTGGG - Intronic
950060789 3:10070103-10070125 GCCCGGCCGCGACCCCGTCTGGG + Intronic
950158057 3:10738794-10738816 GCCCTTTCCCGACCACCTCTGGG - Intergenic
950742355 3:15061817-15061839 GCCCGGCCGCGACCCCGTCTGGG + Intronic
950819490 3:15742418-15742440 ACCTGGCCGCGACCCCGTCTGGG + Intronic
951290511 3:20867106-20867128 GCCCAGCCGCGACCCCGTCTGGG - Intergenic
952418841 3:33113870-33113892 GCCTTTCCCGGGCACCCTCTAGG + Intergenic
952889223 3:38029734-38029756 GTCTCTCCCCGCCCCCTTCTGGG + Intronic
952892600 3:38053431-38053453 GCCCGGCCGCGACCCCGTCTGGG + Intronic
952894024 3:38064693-38064715 GCCCGGCCGCGACCCCGTCTGGG - Intronic
952896597 3:38082110-38082132 GCCTGGCCGAGACCCCGTCTGGG - Intronic
953037768 3:39227738-39227760 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
953084186 3:39651447-39651469 TCCTGGCCGCGACCCCGTCTGGG - Intergenic
953322319 3:41983400-41983422 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
953440184 3:42909823-42909845 GCCTGGCCGCGACCCCGTCTGGG - Intronic
953855083 3:46494595-46494617 ACCCTGCCGCGACCCCGTCTGGG + Intergenic
953922787 3:46964097-46964119 GCCTAGCTGCGACCCCGTCTGGG + Intronic
954048326 3:47952031-47952053 GCCCGGCCGCGACCCCGTCTGGG + Intronic
954060447 3:48061971-48061993 GCCTGACCGCCACCCCGTCTGGG + Intronic
954100838 3:48371528-48371550 GCCTTTCCCCACGCCCCTCTAGG + Intergenic
954162647 3:48733916-48733938 GCCTGGCCGCCACCCCGTCTGGG + Intronic
954162714 3:48734188-48734210 GCCTGGCCGTGACCCCGTCTGGG + Intronic
954481369 3:50804054-50804076 GCCCGGCCGCGACCCCGTCTGGG - Intronic
954529814 3:51308938-51308960 GCCCGGCCGCGACCCCGTCTGGG - Intronic
954566890 3:51607628-51607650 GCCCATCCACCACCCCGTCTGGG - Intronic
954599918 3:51859123-51859145 GCCTGGCCACCACCCCGTCTGGG + Intergenic
954645837 3:52131008-52131030 CCCTCCCCCCGACCCCGTGTGGG - Intronic
955173072 3:56584446-56584468 GCCTGGCCGCGACCCCGTCTGGG - Intronic
955363131 3:58290693-58290715 GCCCGGCCGCGACCCCGTCTGGG - Intronic
955626827 3:60927662-60927684 GCCTGGCCGCCACCCCGTCTGGG + Intronic
955670093 3:61393702-61393724 GCCCTGCCGCCACCCCGTCTGGG - Intergenic
955674588 3:61435043-61435065 GCCCGACCCCGACCCCGTCTGGG - Intergenic
957620351 3:82585163-82585185 GCCTGGCCACCACCCCGTCTGGG + Intergenic
957789256 3:84918751-84918773 GCCCAGCCGCGACCCCGTCTGGG + Intergenic
958108457 3:89107576-89107598 GCCTTTCCGCGAACCCCGCTCGG - Exonic
958431295 3:94044065-94044087 GCCTGCCCGCCACCCCGTCTAGG + Intronic
958560717 3:95744685-95744707 GCCTGGCCACCACCCCGTCTAGG - Intergenic
959415044 3:106073341-106073363 GCCCGGCCACGACCCCGTCTGGG - Intergenic
959683745 3:109124054-109124076 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
960344809 3:116519042-116519064 GCCCTGCCGCCACCCCGTCTAGG + Intronic
960817518 3:121688827-121688849 GCCCGGCCGCGACCCCGTCTGGG + Intronic
960924448 3:122780869-122780891 GCCCGGCCGCGACCCCGTCTGGG - Intronic
961120795 3:124368376-124368398 GCCCGGCCGCGACCCCGTCTGGG - Intronic
961498055 3:127308894-127308916 GCCCTGCCGCCACCCCGTCTGGG + Intergenic
961694942 3:128698230-128698252 GCCCTTCCCCGCTCCCGCCTCGG + Intergenic
961704378 3:128773194-128773216 GCCCGGCCGCGACCCCGTCTGGG + Intronic
962761844 3:138521642-138521664 GCCCGGCCGCGACCCCGTCTGGG + Intronic
963498618 3:146097270-146097292 GCCCAGCCACGACCCCGTCTGGG + Intronic
963911124 3:150819925-150819947 GCCCGGCCACGACCCCGTCTGGG - Intergenic
965136931 3:164784577-164784599 GCCTGGCCGTGACCCCGTCTGGG + Intergenic
965302259 3:167018513-167018535 GCCTGGCCGCCACCCCGTCTGGG + Intergenic
965302316 3:167018745-167018767 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
966206698 3:177412970-177412992 GCCCTGCCGCGACCCCGTCTGGG - Intergenic
966206709 3:177413010-177413032 GCCCTGCCGCGACCCCGTCTGGG - Intergenic
966350974 3:179032643-179032665 GCCCGGCCGCGACCCCGTCTGGG + Intronic
966375397 3:179291022-179291044 GCCCAGCCGCGACCCCGTCTGGG - Intergenic
966784340 3:183609243-183609265 GCCCGGCCACGACCCCGTCTGGG + Intergenic
966966959 3:185003873-185003895 GCCTGGCCGCGACCCCATCTGGG - Intronic
967176386 3:186865051-186865073 GCCCGGCCACGACCCCGTCTGGG + Intergenic
967524179 3:190473111-190473133 GCCTGGCCGCCACCCCGTCTGGG + Intergenic
967578486 3:191124980-191125002 GCCTGGCCGCCACCCCGTCTGGG - Intergenic
967578539 3:191125138-191125160 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
967896606 3:194400645-194400667 GCCCGGCCACGACCCCGTCTGGG + Intergenic
968042458 3:195599859-195599881 GCCCGGCCACGACCCCGTCTGGG - Intergenic
968139414 3:196244135-196244157 GCCAGGCCACGACCCCGTCTGGG + Intronic
968139433 3:196244215-196244237 GCCCGGCCACGACCCCGTCTGGG + Intronic
968507225 4:976336-976358 GCCCGGCCACGACCCCGTCTGGG + Intronic
969384846 4:6837500-6837522 GCCTGGCCGCCACCCCGTCTAGG - Intronic
969508355 4:7602430-7602452 GCCTGGCCGCGACCCTGTCTGGG - Intronic
970216123 4:13761399-13761421 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
970472762 4:16393615-16393637 GCCCGGCCACGACCCCGTCTGGG - Intergenic
972270713 4:37509200-37509222 GCCTGGCCGCCACCCCGTCTGGG - Intronic
972304816 4:37820761-37820783 GCCCTGCCACCACCCCGTCTGGG + Intergenic
972552676 4:40147843-40147865 GCCTGGCCGCGACCCCGTCTGGG - Intronic
972654090 4:41049227-41049249 GCCCAGCCGCGACCCCGTCTGGG + Intronic
972700869 4:41491989-41492011 GCCTGCCCGCCACCCCGTCTAGG - Intronic
972938395 4:44167791-44167813 GCCTGGCTGCGACCCCGTCTGGG + Intergenic
972939708 4:44181851-44181873 GCCCGGCCGCGACCCCGTCTGGG + Intronic
973263282 4:48186266-48186288 GCCTGGCCGCCACCCCGTCTGGG + Intronic
974021307 4:56693874-56693896 GCCTGGCCGCCACCCCGTCTGGG - Intergenic
974082122 4:57224323-57224345 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
975063893 4:70037915-70037937 GCCTGGCCACCACCCCGTCTGGG + Intergenic
975633428 4:76423379-76423401 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
975633552 4:76423750-76423772 GCCTGGCCACCACCCCGTCTGGG + Intergenic
975686223 4:76918335-76918357 GCCCGGCCACGACCCCGTCTGGG + Intergenic
976265536 4:83185128-83185150 GCCCAGCCACGACCCCGTCTGGG - Intergenic
976340959 4:83944248-83944270 GCCTGGCCGCCACCCCGTCTAGG - Intergenic
976607463 4:86996196-86996218 GCCTGGCCACCACCCCGTCTGGG + Intronic
977205092 4:94157955-94157977 GCCCAGCCGCGACCCCGTCTGGG + Intergenic
978123739 4:105110712-105110734 GCCCGGCCACGACCCCGTCTGGG + Intergenic
978409306 4:108410041-108410063 GCCCGGCCACGACCCCGTCTGGG + Intergenic
978519074 4:109597909-109597931 GCCCGGCCGCGACCCCGTCTGGG - Intronic
978527337 4:109679234-109679256 GCCTGGCCGCCACCCCGTCTAGG - Intronic
978820282 4:112957909-112957931 ACCTGGCCGCGACCCCGTCTGGG - Intronic
978947509 4:114516583-114516605 GCCTGGCCGCGACCCTGTCTGGG + Intergenic
979273691 4:118792127-118792149 GCCCGGCCGCGACCCCGTCTGGG + Intronic
979482797 4:121238391-121238413 GCCTGGCCGCCACCCCGTCTAGG + Intergenic
979482903 4:121238769-121238791 GCCTTTGCCCGACCGCGACCCGG + Intergenic
979702517 4:123685038-123685060 GCCCAGCCACGACCCCGTCTGGG + Intergenic
979941748 4:126771244-126771266 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
980368049 4:131832194-131832216 GCATTTCCCTGACCCCTTCATGG + Intergenic
981677385 4:147357685-147357707 GCCTGGCCGCTACCCCGTCTGGG + Intergenic
981994841 4:150963942-150963964 GCCCTGCCGCGACCCCGTCTGGG + Intronic
982040526 4:151391264-151391286 GCCCGGCCACGACCCCGTCTGGG + Intergenic
982192088 4:152866811-152866833 GCCTGGCCGCGACCCCATCTGGG - Intronic
982235655 4:153249187-153249209 GTCTTTCCCCCACCCCCTCTAGG - Intronic
982711115 4:158759595-158759617 GCCTGGCCGCCACCCCGTCTAGG + Intergenic
982723394 4:158881860-158881882 GCCTGGCCGCCACCCCGTCTGGG + Intronic
982723577 4:158882470-158882492 GCCTGGCCGCCACCCCGTCTGGG + Intronic
983906059 4:173183953-173183975 GCCCGGCCGCGACCCCGTCTGGG - Intronic
984206384 4:176792502-176792524 GCCTTTCCCCGGCACTGGCTGGG - Exonic
984728056 4:183040641-183040663 GCCTGGCCACCACCCCGTCTGGG - Intergenic
984728161 4:183040964-183040986 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
984803504 4:183735263-183735285 GCCCGGCCACGACCCCGTCTGGG - Intergenic
988551951 5:32207920-32207942 GCCCTGCCGAGACCCCGTCTGGG + Intergenic
989061617 5:37415825-37415847 GCCCGGCCGCGACCCCGTCTGGG - Intronic
989211609 5:38862594-38862616 GCCTGGCCGCGACCCGGTCTGGG - Intronic
989372253 5:40722547-40722569 GCCTGGCCGCGACCCCGTCTGGG + Intronic
989379989 5:40801247-40801269 GCCCGGCCACGACCCCGTCTGGG + Intergenic
989574721 5:42979336-42979358 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
989575015 5:42980514-42980536 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
989587453 5:43087049-43087071 GCCCGGCCACGACCCCGTCTGGG - Intronic
989648857 5:43666179-43666201 GCCCTGCCACCACCCCGTCTAGG - Intronic
989663492 5:43824680-43824702 GCCCTGCCACCACCCCGTCTGGG - Intergenic
989828844 5:45890617-45890639 GCCCAGCCACGACCCCGTCTGGG + Intergenic
989829014 5:45891084-45891106 GCCTGGCCACCACCCCGTCTGGG + Intergenic
990297779 5:54420718-54420740 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
990297839 5:54420950-54420972 GCCTGGCCGCCACCCCGTCTGGG - Intergenic
990459124 5:56015287-56015309 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
990501181 5:56398242-56398264 GCCCATCCGCCACCCCGTCTGGG - Intergenic
991073840 5:62513906-62513928 GCCCGGCCGCGACCCCGTCTGGG - Intronic
991375115 5:65957974-65957996 GCCCGGCCGCGACCCCGTCTGGG - Intronic
991597836 5:68323625-68323647 GCCTGGCCACCACCCCGTCTGGG - Intergenic
992415839 5:76551200-76551222 GCCCGGCCCCGACCCCGTCTGGG - Intronic
992442952 5:76812286-76812308 GCCAGGCCGCGACCCCGTCTGGG + Intergenic
992463832 5:76985252-76985274 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
992914401 5:81433079-81433101 GCCTGGCCACCACCCCGTCTGGG + Intronic
992963959 5:81983076-81983098 GCCTGGCCACCACCCCGTCTGGG - Intronic
992964248 5:81983817-81983839 GCCTGGCCACGACCCCGTCTGGG - Intronic
993934694 5:93986180-93986202 GCCTGGCCGCGACCCCGTCTGGG + Intronic
994075642 5:95646725-95646747 GCCTCGCCCCGCCCCCGTCGAGG + Intergenic
994140154 5:96333127-96333149 GCCTTTCCCCTCCCACTTCTCGG + Intergenic
994708805 5:103240672-103240694 GCCTTTCCCCCAACCCATCCAGG - Intergenic
994907449 5:105859443-105859465 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
995161714 5:108992398-108992420 GCCTGGCCACCACCCCGTCTGGG - Intronic
995161875 5:108992853-108992875 GCCTGGCCGCGACCCCGTCTGGG - Intronic
995456815 5:112360875-112360897 GCCCTGCCTCGACCCAGTCTGGG + Intronic
995994457 5:118282663-118282685 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
996159865 5:120148062-120148084 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
997321662 5:132983245-132983267 GCCTGGCTGCGACCCCGTCTGGG - Intergenic
997874650 5:137537517-137537539 GCCTGGCCACAACCCCGTCTGGG - Intronic
997892498 5:137687637-137687659 GCCCGGCCACGACCCCGTCTGGG + Intronic
998060042 5:139112486-139112508 GCCCGGCCGCGACCCCGTCTGGG + Intronic
998067412 5:139170548-139170570 GCCCGGCCGCGACCCCGTCTGGG + Intronic
999455678 5:151714200-151714222 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
999532743 5:152480396-152480418 GCCTGGCCGCCACCCCGTCTGGG - Intergenic
1000131923 5:158308574-158308596 GCCTTTCAGCCACCCAGTCTCGG + Intergenic
1001077930 5:168643707-168643729 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1001961846 5:175884327-175884349 CCCTTCCCCCGAGCCCCTCTGGG + Intergenic
1002013612 5:176304867-176304889 GCCTGGCCGAGACCCCGTCTGGG + Intronic
1002031523 5:176433801-176433823 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1002626254 5:180531571-180531593 GCCTGGCCGCCACCCCGTCTGGG - Intronic
1004448848 6:15726631-15726653 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1005069479 6:21851253-21851275 GCCCGGCCACGACCCCGTCTGGG - Intergenic
1005414430 6:25586069-25586091 GCCTGGCCGCCACCCCGTCTGGG - Intronic
1005414509 6:25586309-25586331 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1005414568 6:25586541-25586563 GCCTGGCCGCCACCCCGTCTGGG - Intronic
1005624862 6:27653543-27653565 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1005837645 6:29719732-29719754 GCCCGGCCACGACCCCGTCTGGG + Intergenic
1005860413 6:29896019-29896041 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1005929801 6:30475164-30475186 GCCCTGCCGCGACCCCGTCTGGG + Intergenic
1006004803 6:30993414-30993436 GCCCAGCCGCGACCCCGTCTGGG - Intergenic
1006014188 6:31067366-31067388 GCCCAGCCGCGACCCCGTCTGGG - Intergenic
1006065119 6:31455817-31455839 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1006128554 6:31854681-31854703 GCCTGGCCGAGACCCCGTCTGGG - Intergenic
1006149075 6:31976398-31976420 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1006346331 6:33485872-33485894 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1006346398 6:33486149-33486171 GCCTGGCCGCCACCCCGTCTGGG - Intergenic
1006403858 6:33832870-33832892 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1006515669 6:34544375-34544397 GCCTGTCCGCGACACCGTGTCGG + Exonic
1006623530 6:35383710-35383732 GCCCGGCCACGACCCCGTCTGGG + Intronic
1006826821 6:36941662-36941684 GCCCAGCCACGACCCCGTCTGGG + Intergenic
1007522981 6:42466436-42466458 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1007644349 6:43369114-43369136 GCGTCTCCCCGTCCCCGCCTCGG - Exonic
1007674347 6:43581208-43581230 GCCCTGCCGAGACCCCGTCTGGG - Intronic
1008106393 6:47444244-47444266 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1008184425 6:48371647-48371669 GCCTGGCCGCCACCCCGTCTGGG - Intergenic
1008480758 6:51982281-51982303 GCCCGGCCACGACCCCGTCTGGG + Intronic
1008553777 6:52656234-52656256 GCCTGGCCGCGACCCCGTCTGGG - Intergenic
1008624787 6:53305555-53305577 GCCCAGCCGCGACCCCGTCTGGG - Intronic
1008841642 6:55910340-55910362 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1008926156 6:56894121-56894143 GCCCGGCCACGACCCCGTCTGGG - Intronic
1009398440 6:63228802-63228824 GCCCGTCCCCCACCCTGTCTGGG - Intergenic
1009869250 6:69433648-69433670 GCCTGCCCGCCACCCCGTCTAGG - Intergenic
1010246008 6:73661012-73661034 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1011044760 6:83068417-83068439 GCCATTCCCCGCCCCCCTCAGGG - Intronic
1011291445 6:85781256-85781278 GCCTGGCCGCCACCCCGTCTGGG + Intergenic
1011297416 6:85839155-85839177 GCCCTGCCACCACCCCGTCTGGG + Intergenic
1011426868 6:87239706-87239728 GCCCAGCCGCGACCCCGTCTGGG - Intronic
1012428659 6:99142018-99142040 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1012899623 6:104991367-104991389 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1013204544 6:107934435-107934457 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1013530877 6:111017799-111017821 GCCTGGCCGCCACCCCGTCTGGG - Intronic
1013800089 6:113932111-113932133 GCCTGGCCGCGATCCCGTCTGGG + Intergenic
1014463699 6:121729873-121729895 GCCTGGCCGCGACCCCGTCTGGG - Intergenic
1015252829 6:131144284-131144306 GCCCCGCCACGACCCCGTCTGGG - Intronic
1016476481 6:144433657-144433679 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1016479911 6:144470420-144470442 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1016973638 6:149786629-149786651 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1016973649 6:149786669-149786691 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1017063411 6:150507416-150507438 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1017465136 6:154687316-154687338 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1017493936 6:154966969-154966991 GCCTGGCCGCCACCCCGTCTGGG - Intronic
1017660598 6:156670161-156670183 ACCTGGCCGCGACCCCGTCTGGG + Intergenic
1017851561 6:158309245-158309267 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1017855862 6:158349627-158349649 GCCTAGCCGCTACCCCGTCTGGG - Intronic
1017856026 6:158350197-158350219 GCCTGGCCCCCACCCTGTCTAGG - Intronic
1017981880 6:159407341-159407363 GCCCGGCCACGACCCCGTCTGGG + Intergenic
1018295293 6:162338933-162338955 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1018295546 6:162339610-162339632 GCCTGGCCACCACCCCGTCTGGG + Intronic
1019458645 7:1146003-1146025 GCCCGGCCACGACCCCGTCTGGG - Intergenic
1019474350 7:1236755-1236777 GCCTTTCCGGGACCTCGCCTCGG + Exonic
1019651513 7:2161746-2161768 GCCTGGCCGCGACCCCATCTGGG + Intronic
1019714816 7:2534015-2534037 GCCCGGCCACGACCCCGTCTGGG - Intergenic
1020616202 7:10465246-10465268 GCCTGGCCACCACCCCGTCTGGG - Intergenic
1021440503 7:20669198-20669220 GCCCGGCCACGACCCCGTCTGGG + Intronic
1021647339 7:22800848-22800870 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1021672503 7:23046688-23046710 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1021735963 7:23638187-23638209 GCCCGGCCACGACCCCGTCTGGG + Intronic
1022700266 7:32753697-32753719 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1022757157 7:33304493-33304515 GCCTGGCCACCACCCCGTCTGGG + Intronic
1023044158 7:36197053-36197075 GCCCGGCCACGACCCCGTCTGGG + Intronic
1024305050 7:47922321-47922343 GCCCTGCCACTACCCCGTCTAGG + Intronic
1024305107 7:47922552-47922574 GCCAGGCCGCGACCCCGTCTGGG + Intronic
1024931327 7:54668128-54668150 ACCTGGCCACGACCCCGTCTGGG - Intergenic
1025573035 7:62600002-62600024 GCCTGGCCACGACCCCGTCTGGG - Intergenic
1025775135 7:64554226-64554248 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1025793636 7:64717965-64717987 GCCTGGCCACGACCCCATCTGGG + Intergenic
1025796093 7:64739112-64739134 GCCTGGCCGCGACCCCGTCTGGG - Intergenic
1025803697 7:64809772-64809794 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1025853500 7:65259711-65259733 GCCCGGCCACGACCCCGTCTGGG + Intergenic
1025979091 7:66393255-66393277 GCCTGGCCACGACCCCGTCTGGG - Intronic
1026007992 7:66614673-66614695 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1026008094 7:66614963-66614985 GCCTGGCCACCACCCCGTCTGGG + Intergenic
1026042174 7:66877291-66877313 GCCTGGCCACCACCCCGTCTGGG - Intergenic
1027087564 7:75275200-75275222 GCCTGGCCACCACCCCGTCTGGG + Intergenic
1028535546 7:91887293-91887315 GCCTGCCCGCCACCCCGTCTAGG + Intergenic
1028595694 7:92545166-92545188 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1029279421 7:99426857-99426879 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1029334625 7:99888564-99888586 GCCCAGCCACGACCCCGTCTGGG - Intronic
1029430222 7:100524156-100524178 GCCTGGCCGCTACCCCGTCTGGG - Intergenic
1029963181 7:104709909-104709931 GCCTGGCCGCCACCCCGTCTGGG - Intronic
1030036141 7:105410528-105410550 GCCTGGCCACCACCCCGTCTGGG - Intergenic
1030068570 7:105679196-105679218 GCCTTTCCCTAATCTCGTCTGGG - Intronic
1030288283 7:107848194-107848216 GCCTGGCCGCGACCCCGTCTGGG + Intergenic
1030329320 7:108255730-108255752 GCCCGGCCACGACCCCGTCTGGG + Intronic
1030692674 7:112551697-112551719 GCCCGGCCTCGACCCCGTCTGGG + Intergenic
1030706273 7:112697170-112697192 GCCTGGCCACCACCCCGTCTGGG - Intergenic
1033173096 7:139101252-139101274 GCCCTGCCGCCACCCCGTCTGGG + Intronic
1033185604 7:139225274-139225296 GCCTGGCCACCACCCCGTCTAGG + Intergenic
1033185615 7:139225314-139225336 GCCTGGCCGCCACCCCGTCTGGG + Intergenic
1033294034 7:140114809-140114831 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1033324115 7:140363165-140363187 GCCCGGCCACGACCCCGTCTGGG + Intronic
1033565672 7:142575565-142575587 GCCCGGCCACGACCCCGTCTGGG + Intergenic
1034034169 7:147802130-147802152 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1034638310 7:152585174-152585196 GCCCGGCCACGACCCCGTCTGGG - Intergenic
1034723215 7:153314566-153314588 GCCCGGCCACGACCCCGTCTGGG - Intergenic
1034723569 7:153315476-153315498 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1034961332 7:155366604-155366626 GCCCGGCCACGACCCCGTCTGGG - Intronic
1035412662 7:158657624-158657646 GCCTGGCCACCACCCCGTCTGGG + Intronic
1036507028 8:9365307-9365329 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1037134620 8:15446121-15446143 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1037756290 8:21712321-21712343 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1038595488 8:28881926-28881948 GCCCGGCCACGACCCCGTCTGGG + Intronic
1038744611 8:30246448-30246470 GCCCGGCCACGACCCCGTCTGGG - Intergenic
1038828715 8:31033721-31033743 CCCTTTCCCCGCCCCCGGCCCGG - Intergenic
1039072363 8:33658809-33658831 GCCTGGCCGCCACCCCGTCTTGG - Intergenic
1039201034 8:35094389-35094411 GCCCCGCCGCGACCCCGTCTGGG - Intergenic
1039488182 8:37927802-37927824 GCCTGGCCGCGACCCCGTCTGGG + Intergenic
1039807618 8:41014488-41014510 GCCTGGCCGCGACCCCATCTGGG - Intergenic
1039881221 8:41626580-41626602 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1040041377 8:42919337-42919359 GCCCGGCCACGACCCCGTCTGGG - Intronic
1040069523 8:43179134-43179156 GCCCGGCCACGACCCCGTCTGGG - Intronic
1040093133 8:43419145-43419167 GCCTGGCCACCACCCCGTCTGGG - Intergenic
1040616344 8:49041878-49041900 GCCTGGCCGCCACCCCGTCTAGG - Intergenic
1041066234 8:54085619-54085641 GCCTGGCCGCGACCCCGTCTGGG + Intronic
1041358024 8:57021915-57021937 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1041489093 8:58411567-58411589 GCCTTTCCCCGACCCCGTCTGGG + Intronic
1042133982 8:65616774-65616796 GCCCAGCCGCGACCCCGTCTGGG + Intronic
1042193169 8:66208617-66208639 GCCATTCCCCGAGCCATTCTTGG - Intergenic
1042196264 8:66232909-66232931 GCCTGGCCACCACCCCGTCTGGG + Intergenic
1042303505 8:67310738-67310760 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1042319651 8:67461584-67461606 GCCTGGCCACCACCCCGTCTGGG - Intronic
1042912803 8:73844788-73844810 GCCTGGCCGCGACCCCGTCTGGG + Intronic
1043958442 8:86389677-86389699 GCCTGGCCGCCACCCCGTCTGGG - Intronic
1044507589 8:93039253-93039275 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1044597153 8:93970562-93970584 GCCTGGCCGCCACCCCGTCTGGG - Intergenic
1044597260 8:93970883-93970905 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1045120132 8:99028235-99028257 GCCCGGCCACGACCCCGTCTGGG - Intronic
1045320966 8:101080946-101080968 CCCTCTCCCCGACCCCCTCCCGG + Intergenic
1046599288 8:116297853-116297875 GCCTGGCCGCCACCCCGTCTGGG + Intergenic
1046636927 8:116680298-116680320 GCCCGGCCACGACCCCGTCTGGG + Intronic
1046736017 8:117777630-117777652 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1046791960 8:118332027-118332049 TCCTTTCCCCCACCCCACCTAGG - Intronic
1047719979 8:127630308-127630330 GCCCGGCCACGACCCCGTCTGGG + Intergenic
1047782227 8:128119324-128119346 GCCTGGCCGCCACCCCGTCTGGG - Intergenic
1048031404 8:130636608-130636630 TCCTTTCCCAGACACCGCCTGGG + Intergenic
1048361051 8:133697388-133697410 GGCCTTCCCTGACCCCATCTAGG + Intergenic
1048368358 8:133757585-133757607 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1049177449 8:141202504-141202526 GCCCGGCCACGACCCCGTCTGGG - Intergenic
1049515229 8:143050914-143050936 GCCTTTCCCCGACCCCGAGCCGG - Intronic
1049892469 9:83421-83443 GCCCGGCCACGACCCCGTCTGGG - Intergenic
1049976029 9:861856-861878 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1050132221 9:2424686-2424708 GCCTTTCCCTGACACTGCCTTGG + Intergenic
1050417914 9:5434398-5434420 GCCTGGCCGCCACCCCGTCTGGG + Intronic
1050534903 9:6622923-6622945 GCCTGGCCGCGACCCCGTCTGGG + Intronic
1051258202 9:15234501-15234523 GCCTGGCCACCACCCCGTCTGGG + Intronic
1051276839 9:15406507-15406529 GCCCGGCCACGACCCCGTCTGGG + Intergenic
1052236165 9:26215019-26215041 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1052274818 9:26664373-26664395 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1052858824 9:33423883-33423905 GCCCGGCCACGACCCCGTCTGGG + Intergenic
1052928669 9:34038961-34038983 GCCCGACCGCGACCCCGTCTGGG + Intronic
1052941818 9:34137248-34137270 GCCCTGCCGCCACCCCGTCTGGG + Intergenic
1053048090 9:34936750-34936772 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1053081905 9:35183914-35183936 GCCCTGCCGCCACCCCGTCTTGG - Intronic
1053256016 9:36615941-36615963 GCCTGGCCGCCACCCCGTCTGGG - Intronic
1053467986 9:38324706-38324728 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1053632402 9:39957896-39957918 GCATTTCCCTGACCCCTTCATGG + Intergenic
1053691679 9:40590036-40590058 GCCCTGCCCTGACCCCGTCTTGG + Intergenic
1053784444 9:41644176-41644198 TGCTTCCCCCGACCCCGCCTGGG - Intergenic
1054161338 9:61673871-61673893 GCTTTTCCCAGACTCCGCCTGGG + Intergenic
1054211486 9:62292801-62292823 GCATTTCCCTGACCCCTTCATGG - Intergenic
1054273122 9:63047449-63047471 GCCCTGCCCTGACCCCGTCTTGG - Intergenic
1054302936 9:63391002-63391024 GCCCTGCCCTGACCCCGTCTTGG + Intergenic
1054313496 9:63556052-63556074 GCATTTCCCTGACCCCTTCATGG + Intergenic
1054401717 9:64717518-64717540 GCCCTGCCCTGACCCCGTCTTGG + Intergenic
1054435320 9:65201827-65201849 GCCCTGCCCTGACCCCGTCTTGG + Intergenic
1054495070 9:65819854-65819876 GCCCTGCCCTGACCCCGTCTTGG - Intergenic
1055297964 9:74853092-74853114 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1055580552 9:77703023-77703045 GCCTGGCCGCCACCCCGTCTGGG - Intergenic
1056152472 9:83803934-83803956 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1056336350 9:85573513-85573535 GCCTGGCCGCCACCCCGTCTGGG + Intronic
1056670841 9:88626163-88626185 GCCTGGCCGAGACCCCGTCTGGG + Intergenic
1057154648 9:92830587-92830609 GCCTGGCCACCACCCCGTCTGGG - Intergenic
1057630511 9:96715834-96715856 GCCCAGCCGCGACCCCGTCTGGG - Intergenic
1059118153 9:111617613-111617635 GCCCGGCCTCGACCCCGTCTGGG - Intergenic
1059707712 9:116840399-116840421 GCCTGGCCACCACCCCGTCTGGG - Intronic
1060080135 9:120636711-120636733 GCCCAGCCGCGACCCCGTCTGGG + Intronic
1060186713 9:121568179-121568201 GACTTTCCCCCACCCCATCCAGG + Intronic
1060351746 9:122867044-122867066 GCCTGGCCGCGACCCCGTCTGGG + Intronic
1060351967 9:122867705-122867727 GCCTGGCCGCGACCCCGTCTGGG + Intronic
1060669813 9:125459129-125459151 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1060997390 9:127882871-127882893 GCCTTACCCCCACCCCTCCTTGG - Intergenic
1061427067 9:130506415-130506437 GCCCGGCCACGACCCCGTCTGGG - Intergenic
1203463746 Un_GL000220v1:67877-67899 GCCCTGCCACCACCCCGTCTGGG - Intergenic
1186786868 X:12963328-12963350 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1187212546 X:17245041-17245063 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1187212575 X:17245157-17245179 GCCTGGCAGCGACCCCGTCTGGG - Intergenic
1188086330 X:25905665-25905687 GCCCATCCGCCACCCCGTCTGGG + Intergenic
1188367418 X:29333171-29333193 GCCCGGCCACGACCCCGTCTGGG - Intronic
1189570056 X:42285934-42285956 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1189837451 X:45040033-45040055 GCCCGGCCACGACCCCGTCTGGG - Intronic
1190158959 X:48016713-48016735 GCCTGGCCGCCACCCCGTCTAGG + Intronic
1190159014 X:48016945-48016967 GCCCCGCCGCGACCCCGTCTGGG + Intronic
1190171416 X:48115051-48115073 GCCCTGCCGCCACCCCGTCTGGG + Intergenic
1190241407 X:48659882-48659904 GCCCGGCCACGACCCCGTCTGGG - Intergenic
1190505300 X:51119848-51119870 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1190521079 X:51279971-51279993 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1190779453 X:53579419-53579441 GCCCGGCCACGACCCCGTCTGGG + Intronic
1190793579 X:53721700-53721722 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1190839258 X:54129606-54129628 GCCTGGCCACCACCCCGTCTGGG - Intronic
1190906930 X:54736862-54736884 GCCTGACCACCACCCCGTCTGGG + Intergenic
1191009787 X:55748277-55748299 GCCTGCCCGCCACCCCGTCTGGG + Intronic
1191828612 X:65392174-65392196 GCCTGGCCGCCACCCCGTCTAGG + Intronic
1191828779 X:65392718-65392740 GCCTGGCCACCACCCCGTCTGGG + Intronic
1191835480 X:65457537-65457559 GCCCGGCCACGACCCCGTCTGGG + Intronic
1191894276 X:65975631-65975653 GCCTGGCCGCCACCCCGTCTGGG - Intergenic
1192107223 X:68327250-68327272 GCCCGGCCACGACCCCGTCTGGG + Intronic
1192324744 X:70122852-70122874 GCCTGGCCGCCACCCCGTCTAGG + Intergenic
1192324800 X:70123082-70123104 GCCTGGCCGCGACCCCATCTGGG + Intergenic
1192350140 X:70349723-70349745 GCCTGGCCGCCACCCCGTCTGGG - Intronic
1192500189 X:71645299-71645321 GCCCGGCCGCGACCCCGTCTGGG - Intergenic
1192504970 X:71676089-71676111 GCCTGGCCACCACCCCGTCTGGG + Intergenic
1192610333 X:72560035-72560057 GCCTGGCCACCACCCCGTCTGGG + Intronic
1192664159 X:73069845-73069867 GCCTGGCCGCCACCCCGTCTGGG + Intergenic
1192813603 X:74569402-74569424 GCCTGGCCGCCACCCCGTCTGGG - Intergenic
1192892586 X:75407171-75407193 GCCTGGCCGCGACCCCATCTGGG + Intronic
1193132442 X:77932219-77932241 GCCCGGCCGCGACCCCGTCTGGG - Intronic
1193372314 X:80712790-80712812 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1193924334 X:87465991-87466013 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1195888931 X:109671266-109671288 GCCCAGCCGCGACCCCGTCTGGG + Intronic
1197199281 X:123734210-123734232 GCCCGGCCGCGACCCCGTCTGGG + Intergenic
1198189212 X:134286297-134286319 GCCTAGCCGCCACCCCGTCTGGG - Intergenic
1198246825 X:134839336-134839358 GCCCGGCCGCGACCCCGTCTGGG + Intronic
1198260489 X:134960624-134960646 GCCCGGCCACGACCCCGTCTGGG + Intergenic
1198600721 X:138282570-138282592 GCCTGGCCGCCACCCCGTCTGGG - Intergenic
1198600851 X:138282973-138282995 GCCTAACCGCCACCCCGTCTGGG - Intergenic
1200124411 X:153806478-153806500 GCCTTCTCCCGAACCCATCTTGG - Intronic
1201335711 Y:12878542-12878564 GCCCGGCCCCCACCCCGTCTAGG + Intergenic
1201948247 Y:19535648-19535670 GCCTGACCGCCACCCCGTCTGGG + Intergenic
1202028684 Y:20551432-20551454 GCCTGGCCACCACCCCGTCTGGG + Intergenic
1202028724 Y:20551585-20551607 GCCTGGCCGCCACCCCGTCTGGG + Intergenic