ID: 1041489209

View in Genome Browser
Species Human (GRCh38)
Location 8:58412749-58412771
Sequence ATGAAGACACAGGATCAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 548
Summary {0: 1, 1: 0, 2: 3, 3: 61, 4: 483}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041489209_1041489217 12 Left 1041489209 8:58412749-58412771 CCTGTCTGATCCTGTGTCTTCAT 0: 1
1: 0
2: 3
3: 61
4: 483
Right 1041489217 8:58412784-58412806 GAAGGTCAGGGTGCTGGTGGTGG No data
1041489209_1041489211 -10 Left 1041489209 8:58412749-58412771 CCTGTCTGATCCTGTGTCTTCAT 0: 1
1: 0
2: 3
3: 61
4: 483
Right 1041489211 8:58412762-58412784 GTGTCTTCATTTGTAAACTGAGG No data
1041489209_1041489213 -1 Left 1041489209 8:58412749-58412771 CCTGTCTGATCCTGTGTCTTCAT 0: 1
1: 0
2: 3
3: 61
4: 483
Right 1041489213 8:58412771-58412793 TTTGTAAACTGAGGAAGGTCAGG No data
1041489209_1041489214 0 Left 1041489209 8:58412749-58412771 CCTGTCTGATCCTGTGTCTTCAT 0: 1
1: 0
2: 3
3: 61
4: 483
Right 1041489214 8:58412772-58412794 TTGTAAACTGAGGAAGGTCAGGG No data
1041489209_1041489212 -6 Left 1041489209 8:58412749-58412771 CCTGTCTGATCCTGTGTCTTCAT 0: 1
1: 0
2: 3
3: 61
4: 483
Right 1041489212 8:58412766-58412788 CTTCATTTGTAAACTGAGGAAGG No data
1041489209_1041489218 19 Left 1041489209 8:58412749-58412771 CCTGTCTGATCCTGTGTCTTCAT 0: 1
1: 0
2: 3
3: 61
4: 483
Right 1041489218 8:58412791-58412813 AGGGTGCTGGTGGTGGTGTAAGG No data
1041489209_1041489216 9 Left 1041489209 8:58412749-58412771 CCTGTCTGATCCTGTGTCTTCAT 0: 1
1: 0
2: 3
3: 61
4: 483
Right 1041489216 8:58412781-58412803 GAGGAAGGTCAGGGTGCTGGTGG No data
1041489209_1041489215 6 Left 1041489209 8:58412749-58412771 CCTGTCTGATCCTGTGTCTTCAT 0: 1
1: 0
2: 3
3: 61
4: 483
Right 1041489215 8:58412778-58412800 ACTGAGGAAGGTCAGGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041489209 Original CRISPR ATGAAGACACAGGATCAGAC AGG (reversed) Intronic
902561809 1:17282287-17282309 ATGTAGACACAGAAACAGAGAGG - Intronic
902619939 1:17644925-17644947 ATGAGGCCACAGGCTCAGAGAGG + Intronic
902737295 1:18409533-18409555 AGGAAGAAACAGGATCTGAAGGG - Intergenic
902741380 1:18440966-18440988 AGGGAGACACAGGGTCAGCCAGG - Intergenic
902994068 1:20210255-20210277 ATGAGGAGACTGGATCAGAGAGG + Intergenic
903221755 1:21873261-21873283 ATGAAGAAACAGGCTCGGACAGG + Intronic
903288362 1:22291237-22291259 ATGGAGAGACAGGAACAGAGAGG - Intergenic
903289439 1:22298665-22298687 GTGAAGAAACAGGTTCAGACAGG + Intergenic
903469204 1:23573758-23573780 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
903739414 1:25549949-25549971 AGGGAGAAACAGGACCAGACTGG + Intronic
903992547 1:27283792-27283814 ATGAGCAAACAGGCTCAGACAGG - Intronic
904597001 1:31653141-31653163 ATGAGGACACAGGCTCAGAGAGG + Intronic
904816232 1:33202298-33202320 AAGAAGACACTGTATCAGGCCGG + Intergenic
904846349 1:33420919-33420941 ATGAAGAAACAGGCTCAAAGAGG - Intronic
904940091 1:34159623-34159645 ATGAAGAAACAGGTTCAGAGAGG - Intronic
905476873 1:38235200-38235222 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
906383171 1:45345676-45345698 ATGAAGAAACAGACTCAGAGAGG + Intronic
906800987 1:48736720-48736742 ATGGAAACACCGGTTCAGACAGG + Intronic
907076998 1:51587998-51588020 ATGAGGAAACAGGTTCAGAGAGG - Intronic
907274677 1:53310623-53310645 CTGAGGACGCAGGATCAGCCAGG + Intronic
907647788 1:56261526-56261548 ATGAGAAAACAGGATCAGAGTGG - Intergenic
907662862 1:56409269-56409291 ATGAAGACACCAGGTGAGACCGG - Intergenic
907782201 1:57577560-57577582 ATAAAGAAACAGGCTCAGAGAGG + Intronic
908156673 1:61360414-61360436 AGGGAGACACAGGCTCAGAGAGG - Intronic
908498288 1:64717320-64717342 ATGAAGAAACAGGATGAAAGAGG - Intergenic
908606794 1:65806714-65806736 ATGAAGAGATAGGATCAGTGGGG - Intronic
908797987 1:67850566-67850588 ATGAAGAAAGAGGCTCAGAGAGG - Intergenic
910087322 1:83419021-83419043 AGGGAGACACAGGATGAGAAAGG + Intergenic
911345888 1:96696458-96696480 ATAAAGACCCAGGTTCAGAAGGG - Intergenic
912575418 1:110666640-110666662 AGGAAGAGAAAGGGTCAGACTGG + Intergenic
912587730 1:110782016-110782038 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
913022006 1:114797436-114797458 AAGAAGACACAGGGACACACAGG + Intergenic
913570095 1:120111085-120111107 GTGAAGACAGAGAATAAGACAGG + Intergenic
913675691 1:121138195-121138217 GTGAGGACACAGGATTAGAGGGG + Intergenic
914027590 1:143926136-143926158 GTGAGGACACAGGATTAGAGGGG + Intergenic
914290904 1:146272051-146272073 GTGAAGACAGAGAATAAGACAGG + Intergenic
914551948 1:148722834-148722856 GTGAAGACAGAGAATAAGACAGG + Intergenic
915044855 1:153003587-153003609 ATTAAGACACAGAAACAGATGGG - Exonic
915068769 1:153248097-153248119 ATGAAGATATAGGATCAGAAAGG + Intergenic
915599670 1:156914265-156914287 ATGAGGACACAGGCTCTGAGAGG - Intronic
915698659 1:157769933-157769955 GTGAAGACACAGGGTCTTACTGG - Exonic
915701839 1:157803909-157803931 AAGAAGACACAGGGTCATACTGG - Exonic
915703837 1:157824373-157824395 ATGAAGCCACAGGTGCAGGCTGG + Intergenic
916971657 1:170026069-170026091 ATGAAGACAAAGGCAGAGACTGG + Intronic
917824365 1:178801441-178801463 ATGATGAAACAGGATCAAATGGG - Intronic
917965281 1:180174867-180174889 ATGAAGAAACAGGCTCGGCCAGG + Intronic
918044726 1:180935089-180935111 ATGAAGAGACAGGAGGAGAGAGG - Intronic
918067643 1:181112319-181112341 CTGAAGAAACAGAAGCAGACAGG - Intergenic
918346571 1:183612633-183612655 ACGAAGAAACAGGCTCAGAAAGG + Intergenic
919033406 1:192274950-192274972 ATAAAGTCACAGCATCAGATTGG - Intergenic
919357641 1:196545444-196545466 TTGAGGAAACAGGATCAGGCTGG + Intronic
919743868 1:200996524-200996546 ATGATGAAACAGGCTCAGAGAGG - Intronic
920463059 1:206157031-206157053 GTGAGGACACAGGATTAGAGGGG + Intergenic
920697374 1:208191627-208191649 ATGAAGAAACAGGCACAGAGAGG + Intronic
920959798 1:210654307-210654329 GAGAGGACACAGGAACAGACAGG - Intronic
922057758 1:222057652-222057674 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
922422073 1:225466913-225466935 AGGAAGTCACAGGATGAGATAGG - Intergenic
924018760 1:239757736-239757758 AGGAAGGCACAGGATTAAACTGG - Intronic
1063205382 10:3826217-3826239 ATGGAGACAGAGGAGCACACAGG - Intergenic
1063455043 10:6177062-6177084 TTGAAGCCACAGGATCTGAGAGG - Intronic
1063903971 10:10764342-10764364 GTGAAGACACAGTATGAGATCGG - Intergenic
1064110665 10:12535908-12535930 ATGAGGACACAGGCTCAGAGGGG + Intronic
1065155267 10:22863001-22863023 ATGAGGAAACAGGGTCAGAGGGG + Intergenic
1065165261 10:22970122-22970144 ATGGAAACACAGGATCACCCAGG + Intronic
1066379676 10:34890632-34890654 ATGAAGACAGAGGTTCAGAGAGG - Intergenic
1067067963 10:43114244-43114266 ATGGAGACAGAGGCTCAGAGAGG - Intronic
1067657604 10:48208549-48208571 GTGAAGACTCAGGAGCAAACAGG - Intronic
1067977425 10:51041979-51042001 ATGGAGACTCAGGTTCAGGCAGG - Intronic
1069518920 10:69102110-69102132 AGGAAGAAACAGGATAAGGCAGG - Intronic
1070214352 10:74361197-74361219 ATTAAGACACAGGATAGGCCGGG - Intronic
1075334618 10:121599076-121599098 ATAAGGAAACAGGATCAGAGAGG + Intergenic
1075754898 10:124802601-124802623 ATAAAGACACTGAAACAGACAGG - Intronic
1076238685 10:128885632-128885654 ATGCAGACACATGTTCACACAGG + Intergenic
1077401296 11:2359094-2359116 ATGCAGCCACAGGTGCAGACAGG - Intergenic
1078267496 11:9766017-9766039 ATGAGGAAATAGGCTCAGACAGG + Intergenic
1078707441 11:13758758-13758780 ATGAAGAAACAGAATCAAAGAGG + Intergenic
1078786672 11:14500870-14500892 ATGAATGCACAGAATCAGAGAGG - Intergenic
1079075573 11:17383583-17383605 ATGAGGACACAGGGTCAGAAAGG - Intergenic
1079138889 11:17794448-17794470 ATGAAGAACCAGGCTCAGAGAGG + Intronic
1079307833 11:19339491-19339513 AGGAAGAAACAGCATCAGAGAGG - Intergenic
1080039719 11:27746871-27746893 ATGAAGAAAGAGAAGCAGACAGG + Intergenic
1080113397 11:28595168-28595190 ATGAGGAGACAGAATCAGAATGG - Intergenic
1080595106 11:33766054-33766076 ATGAAGAAACAGGATTAAAGAGG - Intronic
1080929931 11:36799395-36799417 ATGAAGCATCAGGATCAGAATGG - Intergenic
1081691195 11:45079881-45079903 GGGAAGACACAGGGGCAGACAGG - Intergenic
1082078050 11:47989899-47989921 ATGAAGAGCAAGGATCAGAAAGG - Intronic
1082806496 11:57454984-57455006 ATGGAGAAACAGGCTCAGAGAGG - Intergenic
1082997358 11:59264572-59264594 ATGAAGAAACAGGCTCAGGTGGG - Intergenic
1083774862 11:64889448-64889470 AGGAGGACACAGGCTCAGAGAGG - Intergenic
1083902029 11:65647799-65647821 AGGAAGAGACAGGCTCAGACGGG - Intronic
1083935801 11:65869527-65869549 AAGAAGAAACAGGCTCAGAGAGG + Intronic
1084112389 11:67022698-67022720 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1085694295 11:78690755-78690777 AAGATGACTCAGGATCTGACCGG - Intronic
1085793900 11:79519543-79519565 ATGATGACACAGGAACACAGAGG - Intergenic
1085836281 11:79960391-79960413 ATGCACACACACCATCAGACTGG - Intergenic
1086286689 11:85259685-85259707 ATGGAGAGACAGGTTCAGATGGG - Intronic
1086783793 11:90939947-90939969 ATGAGAAAACAGCATCAGACAGG - Intergenic
1087081372 11:94174079-94174101 ATGAAGACACAGAGACACACAGG - Intronic
1088230441 11:107668754-107668776 AACAACACACAGGATCAGATGGG + Intergenic
1089399322 11:118155353-118155375 ATGAAGAAAGAGGCTCAGAGAGG + Intergenic
1089830608 11:121324318-121324340 ATGAAGTAACAGGAGCAGGCAGG - Intergenic
1089929512 11:122296105-122296127 ATGAAGAAATAGGTTCAGAGAGG - Intergenic
1090161640 11:124501605-124501627 AGAAAGACACAGGAAAAGACAGG - Intergenic
1090314761 11:125776410-125776432 AGGAAGACACAGAAACAGATAGG - Exonic
1091443661 12:530643-530665 ATGAAGAAACAGAAACAGAAAGG - Intronic
1091620787 12:2087150-2087172 ATGAGGAGTCAAGATCAGACAGG - Intronic
1091956829 12:4651721-4651743 ATGAGGACATAGGATAAGACAGG - Intronic
1092145554 12:6212252-6212274 ATGAAGAAACAGGCTCCGAGAGG - Intronic
1092733829 12:11560114-11560136 ATGAAGAAACAAGACCAGAGAGG + Intergenic
1092986511 12:13850880-13850902 ATGAAGAAAGAGAATCAGAAAGG - Intronic
1093936900 12:25011111-25011133 ATAAAGAAACAGGTTCAGAGAGG + Intergenic
1094279569 12:28720645-28720667 ATGAAGAAACATGATCAGACTGG + Intergenic
1094341446 12:29416363-29416385 ATGAAGAGACAAGCTAAGACTGG + Intronic
1094794539 12:33955668-33955690 TTGAAGCCACAGGATCAAATAGG + Intergenic
1095106392 12:38238272-38238294 TTGAAGCCACAGGATCAAATAGG + Intergenic
1095704995 12:45227477-45227499 CTGAAGAAACAGGCTCAGAGAGG - Intronic
1096194198 12:49638770-49638792 ATGAGGAAACAGGGTCAGAAAGG - Exonic
1096494911 12:52034180-52034202 AAGAAGAGACAGGACCAGGCAGG - Intronic
1096679697 12:53247405-53247427 ATGAAGGCAGTGGATGAGACAGG - Intergenic
1097290954 12:57914522-57914544 ATGAAGACACAGACTTAGAGGGG + Intergenic
1097484850 12:60183519-60183541 ATTAATACAAAGGATCATACTGG - Intergenic
1097845442 12:64361396-64361418 AATAAGTCACAGGATGAGACAGG + Intronic
1097877309 12:64655238-64655260 ATGAAGACACAGTATATCACAGG - Intronic
1098292642 12:68971626-68971648 ATGAAGTTAGTGGATCAGACTGG - Intergenic
1099821675 12:87719329-87719351 ATGAAGAAACAGACTCAGAAAGG - Intergenic
1099947213 12:89258367-89258389 ATGAAGACACAGGAAGAAAATGG + Intergenic
1100153341 12:91768435-91768457 ATGAAGACACAAGCTTGGACAGG + Intergenic
1101109080 12:101468191-101468213 ATGAAGAAACAGGCTCAGGGAGG - Intergenic
1101823235 12:108200308-108200330 ATGAAGAAACAGGCTCAGAGAGG + Intronic
1101827795 12:108233966-108233988 ATGAGGACACAGGATGAGAGAGG - Intronic
1101852883 12:108418321-108418343 ATGAAGACAGAGGCGGAGACTGG - Intergenic
1102195717 12:111023877-111023899 CTGAAGAAACAGGTTCAGGCAGG + Intergenic
1102570555 12:113824736-113824758 TTGAAGAAACAGGCTCAGAGAGG - Intronic
1103716683 12:122949310-122949332 AAGAAAACAGAGGATCAGAGAGG + Intronic
1104586396 12:130051405-130051427 ATGAAGACAGAGGCACAGAGAGG + Intergenic
1105634350 13:22203062-22203084 CTGAAGCCACAGGGGCAGACTGG - Intergenic
1106193472 13:27474139-27474161 ATGAAGAAACAGGCCCAGACAGG + Intergenic
1106288057 13:28335357-28335379 CTGAAGGCACATTATCAGACGGG - Intronic
1106999782 13:35529156-35529178 ATGAGGACACAGGCTCAGACAGG + Intronic
1107252618 13:38382185-38382207 TTGGAAACACAGGGTCAGACGGG - Intergenic
1107386409 13:39914496-39914518 ATGAAGACAGAGGAAGAGATTGG + Intergenic
1107676862 13:42806681-42806703 ATGAAGACTCAGGAGAAGATTGG - Intergenic
1108101954 13:46966391-46966413 AGGAAGACTCAGGATGAGTCCGG - Intergenic
1109402458 13:61853088-61853110 ATGAAGACACAAGATGAAAATGG + Intergenic
1109570251 13:64179222-64179244 TTGAAGAGACAGGCTAAGACAGG + Intergenic
1109667847 13:65562635-65562657 ATTAAGACACAAGATGAGAATGG + Intergenic
1112237599 13:97650279-97650301 AAGAAGACACAGGAGCAGTATGG + Intergenic
1112461594 13:99607633-99607655 ATGAAAAAACAGGGTCAGAAAGG + Intronic
1112552592 13:100435513-100435535 ATGAATACACGTGATCGGACTGG - Intronic
1113059328 13:106304737-106304759 ATGAAGACACAGGTTAAAAGTGG + Intergenic
1113903820 13:113810161-113810183 CTGAACACGCAGGCTCAGACAGG + Intronic
1114508978 14:23240953-23240975 ATGAAGAGACTGGCTCAGAGAGG + Intronic
1115631173 14:35247044-35247066 ATGATGAAACAGGCTCAGAGAGG + Intronic
1116055922 14:39863741-39863763 AGGCAGACACAGGAGCAGACTGG - Intergenic
1117019094 14:51550822-51550844 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1118743528 14:68758180-68758202 ATGGAGACACTGGATCACAGAGG + Intergenic
1119726605 14:76925212-76925234 ATGAAGACACAGCCTCAGAAAGG - Intergenic
1120421570 14:84292624-84292646 ATGAAGACACAGGCAGAGACTGG - Intergenic
1120483438 14:85081572-85081594 TTGAAGACTGAGGCTCAGACAGG - Intergenic
1120526630 14:85584407-85584429 ATTAAGACACAGCATAAGAAAGG - Intronic
1120876929 14:89383631-89383653 AAGATGACACAGGAAGAGACTGG - Intronic
1121495480 14:94389047-94389069 ATGAGGAAACAGGCTCAGAGCGG + Intronic
1121744892 14:96280342-96280364 ATGAGGAGACAGGTTCAGAGAGG - Intergenic
1122617662 14:103031197-103031219 ATGACGATACAGGAGCACACTGG - Intronic
1123132099 14:105995607-105995629 ATAAAGACCCAGGATCAAACAGG + Intergenic
1123582333 15:21726733-21726755 ATAAAGACCCAGGATCAAACAGG + Intergenic
1123618983 15:22169329-22169351 ATAAAGACCCAGGATCAAACAGG + Intergenic
1123722706 15:23073873-23073895 ATGAGGACACAGGCTCACAGAGG - Intergenic
1125118439 15:36123071-36123093 ATGTAGACACAGAATCAGTTTGG - Intergenic
1125266099 15:37882995-37883017 ATGAAGAGACTGGGTTAGACTGG - Intergenic
1125588840 15:40842262-40842284 ATGAGCAAACAGGCTCAGACAGG - Intergenic
1126407619 15:48337433-48337455 ATGAGGAAACAGGCTCAGAAAGG - Intronic
1126680004 15:51193225-51193247 ATTAGGACACAGCTTCAGACAGG - Intergenic
1126772207 15:52069706-52069728 ATGAAGAAACAGGCTTGGACTGG - Intergenic
1127112046 15:55684801-55684823 ATGAAGGAACAGGATGAGAAAGG + Intronic
1127462580 15:59212857-59212879 GTGAAGACACAGGCAGAGACTGG + Intronic
1127481205 15:59379081-59379103 AAGAATACACAGGATCCAACAGG - Intronic
1127715564 15:61645833-61645855 ATGAAGACAGAGGCAGAGACTGG + Intergenic
1128252489 15:66172802-66172824 ATGAGGAAACAGGCTCAGACAGG + Intronic
1128451707 15:67809699-67809721 ATGAGGAAACAGACTCAGACAGG - Intergenic
1128576879 15:68782360-68782382 ATGAAGAAATAGGCTCAGAAAGG + Intronic
1128937476 15:71759380-71759402 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1129250126 15:74304139-74304161 ATGAGGAGACAGGAGCAGAGAGG - Intronic
1129250438 15:74305888-74305910 ATGAAGAGACAGGATCAGAGAGG - Intronic
1129484718 15:75858935-75858957 AAGAAGACATAGGATTAGAATGG - Intronic
1129713380 15:77832944-77832966 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
1129823333 15:78619233-78619255 GTAAAGACACAGGTTCAGAGAGG - Intronic
1129852061 15:78798996-78799018 ATGAGGAAACAGGCTCAGAGGGG - Intronic
1130250942 15:82300091-82300113 ATGAGGAAACAGGCTCAGAGGGG + Intergenic
1130264824 15:82390926-82390948 AAGAAGACACAGGATTAGAATGG - Intergenic
1130507165 15:84555969-84555991 AAGAAGACACAGGATTAGAATGG + Intergenic
1131052445 15:89357802-89357824 AGGAAGAGACATGATCAGATTGG + Intergenic
1132427698 15:101733163-101733185 AAGAAGACACAGGATTAGAATGG + Intergenic
1133696757 16:8271496-8271518 ATGAGGATACAGGATCAGAGAGG + Intergenic
1133854575 16:9537532-9537554 CTGAAGACAGAGAATCTGACAGG - Intergenic
1134572425 16:15302668-15302690 GTGAAGAAACAGGCTCAGAGAGG - Intergenic
1134729957 16:16453373-16453395 GTGAAGAAACAGGCTCAGAGAGG + Intergenic
1134837586 16:17375066-17375088 AGGCAGACACAGGCTCAGAGAGG + Intronic
1134937476 16:18258527-18258549 GTGAAGAAACAGGCTCAGAGAGG - Intergenic
1135627871 16:24011815-24011837 ATGAAGAAACAGGAACAGAGAGG - Intronic
1136631075 16:31489593-31489615 CTCAAAACACAGGATCTGACTGG + Exonic
1137312967 16:47285161-47285183 CTTAAGACCCAGGATCAGAAAGG - Intronic
1137491708 16:48938488-48938510 ATGAGGAAACAGGTTCAGAGAGG + Intergenic
1137786073 16:51138876-51138898 AGGAAGACAGAGGCCCAGACGGG + Exonic
1137812796 16:51368803-51368825 ATGAAGAAACAGATTCAGAGAGG + Intergenic
1138146464 16:54616643-54616665 AAGAGGACACTGGATCTGACAGG - Intergenic
1138454131 16:57111668-57111690 ATGAGGAGACAGGTTCAGAAAGG - Intronic
1139320860 16:66112634-66112656 AGGAAAACAAAGGACCAGACAGG + Intergenic
1139338595 16:66251478-66251500 ATGAAAAAACAGGCTCACACAGG - Intergenic
1141712557 16:85708383-85708405 GTGAGGACACAGGCTCAGAGAGG + Intronic
1141760171 16:86023031-86023053 ATGAGGAAACAGGCTCAGATAGG + Intergenic
1141990526 16:87606597-87606619 ATGAAGAAACAAGCTCAGAGAGG - Intronic
1143019953 17:3912202-3912224 ATGAAGACACAGGAGGAGTAAGG - Intronic
1143286192 17:5790986-5791008 ATGAGGACACAGAATCCAACAGG - Intronic
1143381197 17:6497507-6497529 ATGAAGATAAAGGGTCAGACTGG + Intronic
1143992093 17:10974480-10974502 CTGAAGACACAGGAACACAGAGG + Intergenic
1144822078 17:18082292-18082314 ATGTAGAAACAGGCTCAGAGAGG + Intergenic
1145768701 17:27477250-27477272 TTTAAGTCACAGGATGAGACAGG - Intronic
1146293439 17:31629842-31629864 GGGAAGACACAGGATCAGTGAGG + Intergenic
1147451169 17:40505412-40505434 GTGAAGACACAGACTGAGACTGG - Intergenic
1147976746 17:44252371-44252393 ATGAGGAAACAGGCTCAGAGAGG + Intronic
1148446235 17:47739287-47739309 ATGGAGACACAGGAAGAGGCTGG - Intronic
1149344767 17:55723600-55723622 ATGAGGAAACAGGCTCAGAGAGG + Intronic
1149386880 17:56151123-56151145 ATGAAGACTGAGGACCAGAGAGG - Intronic
1149514199 17:57267654-57267676 ATGAACACACTAGATCAAACGGG - Intronic
1149922129 17:60669820-60669842 TTTAAGTCACAGGATCAGATAGG - Intergenic
1151209810 17:72536083-72536105 ATGAAGAAACATGTTCAGAGAGG - Intergenic
1152057556 17:78042387-78042409 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1152270641 17:79322718-79322740 ATGAACACACAGGCCCAGAGGGG - Intronic
1153586130 18:6622513-6622535 ATAAAGACTCAGGCTGAGACAGG - Intergenic
1155581131 18:27307703-27307725 ATGTAAACAGAGGATCAGAGGGG - Intergenic
1155591932 18:27436980-27437002 AGGAGGAGACAGGTTCAGACAGG - Intergenic
1156486681 18:37470809-37470831 ATGAAGAGTCAGGATCTGCCTGG - Intronic
1157118259 18:44882708-44882730 AGGCAGACATGGGATCAGACAGG + Intronic
1157267161 18:46235651-46235673 AAGAATATACAGGATGAGACTGG - Intronic
1157655262 18:49380746-49380768 ATGAAGAGACAGGCTCAGAAAGG + Intronic
1157937757 18:51892117-51892139 ATGAAGACAGAGGCACAGATGGG - Intergenic
1158734990 18:60069225-60069247 ATGAAGAGACAGAGTCACACAGG + Intergenic
1159856476 18:73595773-73595795 ATGAAGACGCAGGCTGAGACTGG + Intergenic
1161772074 19:6236349-6236371 ATGAAGATGCTGAATCAGACAGG + Intronic
1162752510 19:12837594-12837616 ATGGAGACACATTGTCAGACAGG - Intronic
1163212034 19:15848036-15848058 TTGCAGACACAGGTTCAGAGAGG - Intergenic
1164145331 19:22509435-22509457 ATGAGGACACAGACTCAGAAAGG + Intronic
1164840799 19:31390730-31390752 ATGAATACACAGGCAGAGACTGG - Intergenic
1164980656 19:32611321-32611343 ATGAAAACACAGGATAAGAAAGG - Intronic
1165390204 19:35534343-35534365 TGGAAGACACAGGAGCAGACAGG + Intronic
1165811197 19:38612893-38612915 ATGAAGACAGAGATGCAGACGGG + Intronic
1165828880 19:38720708-38720730 ATGAAGGCACAGGCCCAGAGAGG + Intronic
1166347973 19:42178123-42178145 ATAGAGACACAGGAACAGAGTGG + Intronic
1166710984 19:44937130-44937152 ATGAAGAAACAGGCCCACACAGG + Intergenic
1166838688 19:45683057-45683079 ATGAGGACACAGCAGCAGAGAGG + Exonic
1167247296 19:48381330-48381352 ATGAGGAAACAGGTTCAGAGGGG - Intergenic
1167608236 19:50493112-50493134 ATGCAGAGACAGGAACAGAGTGG + Intergenic
1167831963 19:52030971-52030993 ATGAAGAAAAAGGAACAGAAAGG + Intergenic
1168233359 19:55047030-55047052 ATGAAGAAACAGGCTCAGAGGGG + Intronic
925134374 2:1516140-1516162 ATGAAGACACAGGTCCAGGTGGG + Intronic
926332758 2:11838647-11838669 ATGAAGCCACAGGAACAGGGAGG + Intergenic
926365665 2:12130803-12130825 ATAAGGACACAGGTTCAGGCTGG - Intergenic
926441562 2:12894285-12894307 ATGAAGAAAAAGGACCACACAGG + Intergenic
926931849 2:18048854-18048876 ATGAAGACACAGGGGAAGGCTGG - Intronic
927672365 2:25079435-25079457 ATAAAGAGGCAGGATCAGAGAGG - Intronic
929033203 2:37667902-37667924 ATGAGAACACAGGCTCAGAAAGG - Intronic
929870166 2:45752549-45752571 ATGAGGAAACAGGCTCAGAGAGG - Intronic
930687093 2:54321407-54321429 ATAAAGACAGAGGCTCAGAGAGG + Intergenic
931173227 2:59827110-59827132 ATGAGGAAACAGGTTCAGAAAGG + Intergenic
932586913 2:73036241-73036263 CTGCAGACACAGGAGCAGAGGGG - Intronic
933545091 2:83699771-83699793 ATGAAAACACAAGCCCAGACTGG - Intergenic
933588975 2:84210668-84210690 ATGAAGAAACAGGCACAGAGAGG - Intergenic
934509027 2:94922064-94922086 ATGAAGACACAGGAACATGGGGG + Intergenic
934862604 2:97776864-97776886 ATGGAGACACAAGACCACACAGG + Intronic
935226388 2:101056716-101056738 ATGAAGGCTCCGGAGCAGACAGG + Intronic
937068510 2:119041192-119041214 ATAAATGCACAGGATCAGAGGGG - Intergenic
937232136 2:120404431-120404453 CTGAAGACATAGGAGCAGCCAGG - Intergenic
937883443 2:126885041-126885063 ATGAAAAATTAGGATCAGACTGG + Intergenic
941078045 2:161028783-161028805 ATACAGACACAAGATGAGACAGG + Intergenic
941409482 2:165136198-165136220 ATGGAAACACAGGATAAGAGAGG - Intronic
941530845 2:166668889-166668911 ATGAGGAAACAGGTTCAGAAAGG + Intergenic
941834321 2:169999586-169999608 ATGAAGGCACAAGATCTAACAGG - Intronic
942250700 2:174045394-174045416 AAAAAGATTCAGGATCAGACGGG + Intergenic
944175471 2:196823860-196823882 ATGAAGACACAGACTCAGAGAGG + Intergenic
945581341 2:211598982-211599004 ATGAAGACACAAGTTCTGAGAGG - Intronic
946473875 2:219989177-219989199 ATGAAGACAGAGGCAGAGACTGG + Intergenic
946593391 2:221277228-221277250 ATGAATACACAAGTACAGACTGG + Intergenic
946889360 2:224259457-224259479 ATGATCAGACAGGATCAGAGTGG - Intergenic
948111186 2:235457181-235457203 ATGAAGACAGAGGCAGAGACTGG + Intergenic
948771504 2:240253429-240253451 ATGAAGACAGAGGCAGAGACGGG - Intergenic
1168941906 20:1719967-1719989 ATGAGGACACAGGTTTAGAGAGG - Intergenic
1169319821 20:4623385-4623407 ATGAAGAAACTGCATCAGCCGGG - Intergenic
1170771529 20:19337009-19337031 ATGAAGAAACAGACTCAGAGAGG - Intronic
1172024062 20:31935983-31936005 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1172840423 20:37899869-37899891 ATGAGGACATAGGTTCAGAAAGG - Intergenic
1173132350 20:40406358-40406380 ATGAAAACGGAGGCTCAGACTGG + Intergenic
1173541559 20:43856007-43856029 ATGAGGACATAGGCTCAGAGAGG - Intergenic
1173868087 20:46325529-46325551 ATGAAGAAACATGCTCAGAGAGG - Intergenic
1173943281 20:46930375-46930397 ATGAGGAAACAGGCTCAGAAAGG + Intronic
1174777449 20:53358181-53358203 ATAAAGACACAGGCTAAAACTGG - Intronic
1175044285 20:56089781-56089803 ATAAAGATACAGCATCAGAGAGG - Intergenic
1175420366 20:58828732-58828754 ATCAAGACAAGGTATCAGACAGG - Intergenic
1175477162 20:59284964-59284986 ATGAGGACACTGGCTCAGAAGGG - Intergenic
1175992254 20:62795492-62795514 AACAAGACACAGGTTCAGGCTGG - Intergenic
1178464479 21:32834366-32834388 ATGAAGAGACATGTTCAGAGTGG + Intergenic
1178761832 21:35410603-35410625 AGGATGACACAAGATCAGGCAGG - Intronic
1179576280 21:42310415-42310437 AGGAAGGCACAGGCTCAGGCTGG + Intergenic
1180893006 22:19304631-19304653 AGGATGACTCAGGATCAGTCAGG - Intergenic
1181783701 22:25210469-25210491 ATGAAGAAACAGGCTCAGGGAGG + Intergenic
1181937282 22:26447997-26448019 ATGAGGAAACAGGCTCAGAGCGG + Intronic
1182254370 22:29027622-29027644 ATGATGACACAGCATGAGTCTGG - Intronic
1182943225 22:34298138-34298160 ATGATGACACAGAGTCAAACTGG - Intergenic
1183001871 22:34866903-34866925 ATGAAAATACTGGGTCAGACAGG + Intergenic
1183321628 22:37168521-37168543 ATGCAGAAACAGGCTCAGAGAGG - Intronic
1183711849 22:39509247-39509269 ATCAAGAGACAGGATCAGCCGGG - Intronic
1184101962 22:42345441-42345463 GAGAAGAAACAGGTTCAGACTGG + Intergenic
1184204369 22:42992063-42992085 ATGAAAAGACAGCCTCAGACAGG + Intronic
1184410612 22:44323982-44324004 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
1184444117 22:44537259-44537281 ATGAGGAAACAGGCTCAGAGGGG + Intergenic
1184480513 22:44744176-44744198 ATGAGGATGCAGGATCAGGCGGG + Intronic
1184484185 22:44766085-44766107 ATGCAGACCCAGGATCAGGTTGG - Intronic
1184485190 22:44774060-44774082 ATGGAGACACGGGTTGAGACAGG + Intronic
1184951166 22:47843556-47843578 AAGAGGACACTGGAACAGACAGG - Intergenic
949751344 3:7355845-7355867 ATGAAACCACAGGTGCAGACTGG - Intronic
949905913 3:8858339-8858361 ATGAAGCCACAGGTGCAGGCTGG - Intronic
950005995 3:9691340-9691362 ATGCACACACAGGATGGGACGGG - Intronic
950182989 3:10928043-10928065 ATGAAGACACAGAAGCACAGAGG - Intronic
950185650 3:10943829-10943851 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
950347099 3:12306424-12306446 ATGAAGAAACAGGAACAGAGAGG + Intronic
950458591 3:13107481-13107503 ATGGAGAAACAGGCTCAGAGCGG + Intergenic
950677080 3:14560817-14560839 AGGAAGACACTGGATTAGTCAGG - Intergenic
951051159 3:18095710-18095732 ATGAAGAAACAGGCACAGAAAGG - Intronic
951944020 3:28114054-28114076 CTGAAAACACAGGTTCAGAGAGG - Intergenic
952528777 3:34241878-34241900 ATGAAGAAACATGATCAGAGAGG - Intergenic
952865014 3:37849312-37849334 ATTAAGACACAGGCCCAGGCCGG - Intergenic
952935370 3:38393724-38393746 ATGAAGACACAGGGACACACAGG - Intronic
954460973 3:50626746-50626768 ATGCAGAGACAGGTTCAGAAAGG + Intronic
954512788 3:51142140-51142162 CTGAAGACACAGGATATAACTGG - Intronic
955008477 3:54991765-54991787 ATGAAGAAACAGGCTCAGAGAGG - Intronic
955448598 3:59042121-59042143 ATGAATACACAGGAATTGACTGG + Intronic
955448828 3:59044889-59044911 ATGAAACCACAGTTTCAGACAGG + Intronic
955664301 3:61333886-61333908 AAAAAGACACAGGATGAGAGGGG + Intergenic
955774070 3:62415009-62415031 AAGGAGACAAAGCATCAGACGGG - Intronic
956647436 3:71470230-71470252 ATGAAGAAACAGGCTCAGGAAGG - Intronic
956743197 3:72290976-72290998 AGGAAGAGACAGAAACAGACAGG + Intergenic
957264927 3:77950761-77950783 ATGAAGAAAAAGCATCAGAAAGG - Intergenic
958685785 3:97391473-97391495 GTGAAGAAATAGGATCAGCCTGG - Intronic
959751002 3:109834962-109834984 ATGAAGAAACAGGCTTAGAGAGG + Intergenic
960067062 3:113385351-113385373 ATAAAGAAACAGGATCAACCAGG + Intronic
961615652 3:128177851-128177873 ATGAAGGCAGAGTATCAGACAGG + Intronic
961797777 3:129422089-129422111 ATGATCACACAAGATCAGACTGG - Intronic
961827020 3:129604443-129604465 ATGAAGAAACAGGCACAGAGAGG - Intronic
961983873 3:131111648-131111670 ATGAGGAAACAGGTTCAGAGAGG - Intronic
962694261 3:137932096-137932118 CTGAAGCCAAAGGATAAGACTGG - Intergenic
964450548 3:156808625-156808647 ATGAAGAAACAAATTCAGACAGG - Intergenic
964837341 3:160954111-160954133 ATGAAGAAACAGACTCAGAGAGG - Intronic
966406288 3:179601866-179601888 ATAAAGAAACAGGTTTAGACAGG - Intronic
966586265 3:181629025-181629047 ATGAAGAAACAGGCTCAGAGAGG - Intergenic
967322597 3:188209432-188209454 AGAAAGACACAGGTTCAGAATGG + Intronic
967928665 3:194673846-194673868 ATGAAGACACAGAAGTGGACTGG + Intergenic
967980773 3:195063896-195063918 ATGAAGAAACAGGCCCAGAGAGG + Intergenic
969067256 4:4496328-4496350 ACCAAGACACAGGATCTCACTGG - Intronic
969257515 4:6012357-6012379 ATGAGGAAATAGGATCAGAGGGG + Intergenic
969688041 4:8687921-8687943 CTGAGGAAACAGGATCAGAGAGG + Intergenic
970138730 4:12956447-12956469 ATGAAGAAACAGGCTCAGCAAGG - Intergenic
971356264 4:25897810-25897832 ATGAAGACAGAGGCAGAGACTGG - Intronic
971695314 4:29894673-29894695 ATTAAGACACAAGACTAGACTGG + Intergenic
971700923 4:29974238-29974260 ATGAAGACACAGTGTAAGAAAGG - Intergenic
971946302 4:33282860-33282882 ATGAAGACACAGGAAGAAAGTGG - Intergenic
972445891 4:39143607-39143629 ATAAACACTCAGGATCTGACAGG - Intergenic
972600398 4:40566941-40566963 ATGAAGACACAGAATGGGCCGGG - Intronic
973876299 4:55223093-55223115 ATGAGGAAACAGGTTCAGAGAGG - Intergenic
975371055 4:73588608-73588630 ATGAGGACACAGGCACAGAGGGG - Intronic
975452471 4:74545507-74545529 ATGAAGACAGAGAATCACAGTGG - Intergenic
975471276 4:74771438-74771460 ATGAACATACAGGAACACACAGG + Intronic
977191996 4:94012540-94012562 ATGAGGACACAGGCTCAGCATGG + Intergenic
978222102 4:106289473-106289495 ATGAAGACAATTGATCAGCCAGG + Intronic
978665323 4:111175054-111175076 ATGAAGTCACAGGTACAGACTGG - Intergenic
981141505 4:141274966-141274988 TTGAAGAAAGAGGAACAGACAGG - Intergenic
981149047 4:141360152-141360174 AAAAAGGCCCAGGATCAGACGGG - Intergenic
981162320 4:141513357-141513379 GTGAAGAAACAAGATCAGATGGG - Intergenic
982882522 4:160737899-160737921 ATAAAGAAACAGAAGCAGACTGG - Intergenic
986199230 5:5566485-5566507 ATGAAGAAACGGCATCAGAAAGG + Intergenic
987258607 5:16180929-16180951 CCGAAGACCCAGGATCAGAAAGG + Intergenic
988288942 5:29259575-29259597 ATAAAGACACAGGCACAGAAAGG + Intergenic
989074762 5:37552357-37552379 ATAAAGACACTGGTTCAGAAAGG - Intronic
989518127 5:42367381-42367403 ATGAAGACACTGGAACAAATAGG + Intergenic
990303686 5:54474227-54474249 GTGAAGACACAGGGACAGACAGG - Intergenic
990895763 5:60699208-60699230 ATGAATACACAGGAAAAGATGGG - Intronic
992261209 5:74972093-74972115 ATGAAGACACAGCAGCAGGGTGG + Intergenic
992947758 5:81826100-81826122 ATGAGGACACAGGCTCAGGAGGG + Intergenic
993130995 5:83898141-83898163 TCGAAGTCACAGGATGAGACAGG + Intergenic
993189349 5:84661525-84661547 ATGTAGAAACAGGCTCAGAAAGG + Intergenic
993404862 5:87499299-87499321 TTAAAGACACAGGATCAGGGTGG - Intergenic
993717729 5:91292076-91292098 TTTAAGACACAGGATGAGATAGG - Intergenic
995314664 5:110754850-110754872 ATGAGGAGATAGGATCAGAGGGG - Intronic
995626163 5:114078514-114078536 ATGAAGACAGATGATCAGCAGGG + Intergenic
995793255 5:115916092-115916114 ATGGACAAAAAGGATCAGACAGG + Intergenic
996255168 5:121392008-121392030 CTGAAGACACAGGATCATCAGGG + Intergenic
996496615 5:124164504-124164526 ATGAAAACACAAGATGAGCCTGG + Intergenic
997235307 5:132269072-132269094 ATAAAGAAACAGGTTCAGAGAGG + Intronic
997639636 5:135440207-135440229 ATGAGGAAACAGGATCAGAGAGG - Intergenic
997817989 5:137036404-137036426 AGGAGGACACAGGAGCAGATGGG - Intronic
997897961 5:137736723-137736745 ATGAAGACATGGGATTTGACTGG - Intergenic
998229929 5:140354589-140354611 ATGAGGAAACAGGCTCAGAGAGG - Intergenic
998984004 5:147735017-147735039 ATGCAAACAGAGGGTCAGACAGG + Intronic
999020653 5:148162242-148162264 ATAGAGACACAGAAACAGACAGG + Intergenic
999139963 5:149353900-149353922 ATAAAGAAACAGGCTCAGAAGGG - Exonic
999307844 5:150532033-150532055 ATGAAGACACAGGCTTACAGCGG + Intronic
999838487 5:155399968-155399990 ATGAAGACACAGAGACAGACAGG - Intergenic
1000399625 5:160812357-160812379 ATGAAGACTCAGGACTATACTGG + Intronic
1000541419 5:162545122-162545144 ATGAAGAAACAGGATCCCTCTGG + Intergenic
1001272032 5:170320102-170320124 TTGAAGACAGAGGAAGAGACTGG - Intergenic
1001399872 5:171440099-171440121 AAGAGGAAACAGGATCAGAAAGG - Intronic
1001553855 5:172623069-172623091 ATTAAGAAACAGGCTCAGAGAGG - Intergenic
1001741022 5:174052725-174052747 GTGCAGAAACAGGCTCAGACAGG + Intronic
1001778734 5:174349275-174349297 ATGAAGACAGAGTATCTGAAAGG - Intergenic
1002033996 5:176451581-176451603 ATGAAGAAACAGGTTCTGAGAGG + Intronic
1002478130 5:179481565-179481587 ATCAAGACACAGGATGGGCCAGG - Intergenic
1002533649 5:179864281-179864303 ATCAGGACACAGGCTCAGAGAGG + Intronic
1002762566 6:213390-213412 GTGAAGACACAAGCTCAGAGAGG - Intergenic
1004444124 6:15682165-15682187 TTGAAGAAACAGGCTCAGAATGG - Intergenic
1006428651 6:33981942-33981964 ATAAAGAAACAGGCTCAGAGAGG - Intergenic
1006811632 6:36824028-36824050 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1006836917 6:37004610-37004632 AGGAAGAAACAGAATCAGAGAGG - Intergenic
1006841242 6:37029134-37029156 ATGAAGACACCGACTCAGAGAGG + Intergenic
1007110780 6:39312533-39312555 GTGAAGAAACAGGCTCAGAGAGG - Intronic
1007209662 6:40182643-40182665 ATGAAGAAGCAGGGTCACACTGG + Intergenic
1007340770 6:41190230-41190252 ATGAGGAAACAAGATCAGAGAGG + Intergenic
1007428679 6:41763778-41763800 ATGAGGAAACAGGTTCAGAGAGG + Intergenic
1007531827 6:42549523-42549545 AAAAAGAAACAGGATCAGGCTGG - Intergenic
1007760293 6:44129069-44129091 ATGAAAACTGAGGTTCAGACAGG - Intronic
1008112691 6:47510430-47510452 ATGAAGATACAAGATAAGCCTGG + Intronic
1009977119 6:70683064-70683086 ATGAATACCCAGTAACAGACTGG - Intronic
1010388340 6:75308397-75308419 ATGAGGAAACAGGCTCAGATGGG + Exonic
1010777689 6:79905999-79906021 GTGAAGACACAGGCAGAGACTGG - Intergenic
1011221859 6:85063269-85063291 ATGAAGGCAGAGGCTAAGACTGG - Intergenic
1012003369 6:93682241-93682263 AAGAATAAACAGGATCAGAAAGG - Intergenic
1013609399 6:111779939-111779961 AAGAAGAAACAGGCTCAGAGAGG + Intronic
1013995532 6:116303759-116303781 ATGAAGACTTTGGATCAGAATGG + Intronic
1014685400 6:124492989-124493011 ATGAAGACACAGGCTTACAGTGG - Intronic
1014753391 6:125277522-125277544 ATGAAGACACGGTATTAAACAGG - Intronic
1015073199 6:129122825-129122847 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1015774375 6:136798780-136798802 ATGAAGAAACAGGTCCAGAAAGG - Intergenic
1015937717 6:138419683-138419705 TTGTAGACACAGCATCATACAGG - Exonic
1016479530 6:144467236-144467258 CTGAAGACAGATGAGCAGACAGG - Intronic
1016648966 6:146442034-146442056 GTGAAGTTACAGGATAAGACCGG + Intergenic
1017145275 6:151229197-151229219 TCTAAGTCACAGGATCAGACAGG + Intergenic
1017567969 6:155709190-155709212 ATGAAGACACTGCATCCTACAGG - Intergenic
1019509159 7:1408645-1408667 ATGAGGAAACAGGCTCAGAGAGG - Intergenic
1019845331 7:3493808-3493830 ATGTAGAGACAGATTCAGACTGG - Intronic
1020677715 7:11200710-11200732 ATGAAGAGACAGTATCAAAGAGG + Intergenic
1021601372 7:22367302-22367324 ATAAAGAAACAGGCTCAGAGAGG - Intergenic
1021800443 7:24300186-24300208 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
1022408593 7:30118046-30118068 ATGATGACCCAGCATGAGACAGG + Intronic
1022525791 7:31036347-31036369 ATGAAGAAACAGGCTCAGAAAGG + Intergenic
1022599325 7:31742118-31742140 ATGAAGAAAGAGAATGAGACTGG + Intergenic
1022655699 7:32317978-32318000 ATAAAGAGACAGGGTCAGAGAGG + Intergenic
1022782223 7:33597767-33597789 ATCAAGACAGAGGCTCAGAGAGG - Intronic
1023186096 7:37534695-37534717 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
1024013068 7:45287120-45287142 ATGAAGTCACAGGTACAGACAGG - Intergenic
1024156942 7:46635916-46635938 AGGAAGACACAGGCTCTCACAGG - Intergenic
1024483928 7:49894729-49894751 CTGGAGACACAGGAGCAGCCAGG + Intronic
1024491797 7:49994342-49994364 ATGAAGCCATAGGTTCAGCCTGG + Intronic
1024652153 7:51413399-51413421 CTGAAGACACATGATCATAAAGG + Intergenic
1024920916 7:54553853-54553875 TTGGAGACACTGGATGAGACAGG - Intronic
1025003739 7:55339553-55339575 AGGAAGGCACAGGGCCAGACAGG + Intergenic
1025241672 7:57281826-57281848 TCGAAGTCACAGGATGAGACAGG + Intergenic
1026836933 7:73645852-73645874 ATGAGGAAACAGGCTCAGAGAGG - Intergenic
1027304201 7:76875505-76875527 AGGGAGACACAGGATGAGAAAGG + Intergenic
1028003469 7:85531400-85531422 ATGAAGACAGAGGCTGAGACTGG - Intergenic
1028829138 7:95307398-95307420 ATGATGACACAAGATGAGAAAGG + Intronic
1029138760 7:98394713-98394735 ATAGAGACACAGGAGCAGACTGG - Intronic
1029358682 7:100072154-100072176 CTGAAGACACAAGATCACATGGG - Exonic
1029603798 7:101586135-101586157 ATGAGGACACTGGCTCAGAGAGG + Intergenic
1030224644 7:107136374-107136396 ATGAAAAGACAGGCTCAGACTGG + Intronic
1032482351 7:132257025-132257047 ATGAAGACACAGGTTGGGAGGGG + Intronic
1033179742 7:139164320-139164342 ATGAGGAAACAGGCTCAGAAAGG + Intronic
1035317816 7:158007616-158007638 ATGAAGACACAGAAGGGGACAGG + Intronic
1035356924 7:158281523-158281545 ATGAAGACACAGATCCAGACTGG + Intronic
1036134296 8:6145423-6145445 ATGAAGACACAGTCACAGCCCGG + Intergenic
1036776574 8:11617101-11617123 ATGAACAAACAGAATCAGAGAGG + Intergenic
1037660057 8:20918741-20918763 GTGAAGACACAGGATGAGATGGG + Intergenic
1038134068 8:24766884-24766906 ATGAAGACACAGGAGCAAGCTGG + Intergenic
1038421728 8:27438027-27438049 ATGAGGACACAGGGTCAGAGAGG - Intronic
1038967047 8:32585978-32586000 ATGAAGAAACAGAAACAGAGAGG - Intronic
1039099955 8:33930282-33930304 AAGAAGACTAAGGATCTGACAGG - Intergenic
1039307632 8:36279867-36279889 ATGAAAGCACATGGTCAGACTGG - Intergenic
1039969509 8:42309062-42309084 GTGAAGAGAAAGGAACAGACAGG - Intronic
1041489209 8:58412749-58412771 ATGAAGACACAGGATCAGACAGG - Intronic
1042674603 8:71306145-71306167 ATGAAGACACCTGGTTAGACTGG + Intronic
1042694805 8:71545160-71545182 ATGAAAAAGCAGGTTCAGACTGG - Intronic
1044791278 8:95849540-95849562 ATGAAGAAAGGGGATCAGATAGG + Intergenic
1044803160 8:95977724-95977746 AGGAAGAAACAGGCTCAGAGAGG - Intergenic
1045220578 8:100195454-100195476 ATAAAGACAAAGGAACAGAAAGG + Intronic
1045300970 8:100909562-100909584 ATGAACAGACAGGAGGAGACCGG + Intergenic
1045837830 8:106544157-106544179 ATTAAGAGACAGGATAAGAGTGG - Intronic
1046070583 8:109248137-109248159 TTGAAGACACAGGATGGGCCCGG + Intronic
1046220906 8:111213138-111213160 ATGAAGACAAAGGCAGAGACTGG + Intergenic
1046856434 8:119037422-119037444 ATGAAGACACTGGCATAGACAGG - Intronic
1047713839 8:127577381-127577403 ATGAGAAAACAGGCTCAGACAGG - Intergenic
1048247721 8:132827044-132827066 TTGAAGATACAGGATCAAAATGG + Intronic
1048253369 8:132885900-132885922 GTGAAGACACAGGCACAGATTGG - Intronic
1048511973 8:135071290-135071312 ATGAAGAAATAGGATCAGAAAGG - Intergenic
1050068838 9:1789327-1789349 ATGAGGACACAGGACCAGGAAGG - Intergenic
1050501505 9:6303002-6303024 ATGAAAACACAGGCACAAACTGG - Intergenic
1051530346 9:18095209-18095231 ATGAAAACACTGCATCAGAAAGG + Intergenic
1051854642 9:21550002-21550024 ATGAGGAGACAGGATCAGAGAGG - Intergenic
1052067319 9:24038142-24038164 ATGAAGGCACAGGAAGTGACTGG - Intergenic
1053153087 9:35755175-35755197 ATGAGGAAACAGGCTCAGAGAGG - Exonic
1054885319 9:70191490-70191512 ATCAAGAAACAGGACCAGAGGGG - Intronic
1055674677 9:78644992-78645014 ATGAAGACAGAGCATAAAACAGG - Intergenic
1055807051 9:80107599-80107621 ATCAAGATGCAGGATCAGAGAGG + Intergenic
1055877103 9:80956265-80956287 GTGAAGACAGAGGCTGAGACTGG + Intergenic
1057865808 9:98679796-98679818 CTGAAGACACAGGAGCACAGAGG + Intronic
1058369528 9:104249062-104249084 ATGAGGACACATGCTTAGACAGG + Intergenic
1058665492 9:107310822-107310844 ATGAAGAAACAGGCTTAGAAAGG + Intronic
1058812675 9:108656520-108656542 AAGAAGGCTCTGGATCAGACAGG + Intergenic
1059439599 9:114299570-114299592 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1059497022 9:114718470-114718492 AAGGAGACAGAGGATTAGACAGG - Intergenic
1059757785 9:117309999-117310021 ATGAAGAAACAGGCTCAGAAAGG - Intronic
1060066045 9:120501971-120501993 ATGAGGAAACAGGCTGAGACAGG + Intronic
1060173147 9:121478061-121478083 ATGAAAACAGAGGCTCAGAAAGG + Intergenic
1060279260 9:122204951-122204973 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1060900977 9:127258012-127258034 ATGAGGAAACAGGCTCAGAGAGG + Intronic
1061684759 9:132266227-132266249 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1061752241 9:132787402-132787424 ATGAAGGCTCAGGATCAGATTGG + Intronic
1062514823 9:136927527-136927549 CTGAAGACACGGGAAGAGACTGG - Intronic
1062521935 9:136961556-136961578 ATAAAGAGACCGGATCAGGCAGG - Intergenic
1185681772 X:1894216-1894238 AGGAAGACACAGAAAGAGACAGG - Intergenic
1185819100 X:3184614-3184636 ATGAGGACACAGGCTCAGTTGGG + Intergenic
1185841789 X:3398782-3398804 TAGAAGTCACAGGATGAGACAGG + Intergenic
1186044146 X:5516103-5516125 ATGAAGACACAGACACACACAGG - Intergenic
1186614471 X:11172120-11172142 ATGACGCCACAGGATGAGAGTGG - Intronic
1189205841 X:39238183-39238205 ATCAAAACACAGGATGTGACGGG + Intergenic
1189397366 X:40634984-40635006 GGGAAGCCACAGGATCAGAAGGG + Intronic
1190524878 X:51318782-51318804 GTGAATACACAGGCTCAGAGGGG + Intergenic
1190545356 X:51520125-51520147 GTGAATACACAGGCTCAGAAAGG - Intergenic
1190619499 X:52271120-52271142 ATGAAGGCTCATGGTCAGACTGG - Intergenic
1190689105 X:52898882-52898904 ATGAGGTAACAGGATCAGAGAGG - Intronic
1190696878 X:52956910-52956932 ATGAGGTAACAGGATCAGAGAGG + Intronic
1190721597 X:53153335-53153357 ATGAGGCCACAGGTGCAGACTGG + Intergenic
1191688971 X:63920703-63920725 ATGGGGAAACAGGATCAGACAGG - Intergenic
1193107303 X:77690641-77690663 ATGAATACCCAAGATCAAACTGG - Intronic
1193184544 X:78496638-78496660 ATGAATAGACAGGATTAGAAAGG + Intergenic
1194817959 X:98468225-98468247 ATGAAGAAATAGGATTTGACAGG + Intergenic
1196668012 X:118336514-118336536 ATGAGGACACATGAACAGAAAGG + Intergenic
1196960790 X:120998748-120998770 GTGAAGACAGAGGATCAAAAAGG + Intergenic
1197286660 X:124603027-124603049 ATGAAGACAGAGGCAGAGACTGG + Intronic
1198377066 X:136050725-136050747 AGGAAGAGACAGGCTCAGGCAGG - Intergenic
1199948761 X:152688691-152688713 GTGAAGACACAGGAAGAGAATGG + Intergenic
1199960915 X:152779758-152779780 GTGAAGACACAGGAAGAGAATGG - Intergenic