ID: 1041489212

View in Genome Browser
Species Human (GRCh38)
Location 8:58412766-58412788
Sequence CTTCATTTGTAAACTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041489209_1041489212 -6 Left 1041489209 8:58412749-58412771 CCTGTCTGATCCTGTGTCTTCAT 0: 1
1: 0
2: 3
3: 61
4: 483
Right 1041489212 8:58412766-58412788 CTTCATTTGTAAACTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041489212 Original CRISPR CTTCATTTGTAAACTGAGGA AGG Intronic
No off target data available for this crispr