ID: 1041493286

View in Genome Browser
Species Human (GRCh38)
Location 8:58458854-58458876
Sequence TACCCAAAACTGCAGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041493286_1041493289 20 Left 1041493286 8:58458854-58458876 CCATTGTCCTGCAGTTTTGGGTA No data
Right 1041493289 8:58458897-58458919 TTAATAGTAATTAGCAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041493286 Original CRISPR TACCCAAAACTGCAGGACAA TGG (reversed) Intergenic
No off target data available for this crispr