ID: 1041493785

View in Genome Browser
Species Human (GRCh38)
Location 8:58463991-58464013
Sequence GCTGATTTCAGATTTAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041493784_1041493785 -10 Left 1041493784 8:58463978-58464000 CCTTGAAGAAATGGCTGATTTCA 0: 4
1: 35
2: 144
3: 445
4: 1081
Right 1041493785 8:58463991-58464013 GCTGATTTCAGATTTAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041493785 Original CRISPR GCTGATTTCAGATTTAAGAC AGG Intergenic
No off target data available for this crispr