ID: 1041494851

View in Genome Browser
Species Human (GRCh38)
Location 8:58474365-58474387
Sequence TAGCAAAGCCAGAATCTCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041494851_1041494853 13 Left 1041494851 8:58474365-58474387 CCTATGAGATTCTGGCTTTGCTA No data
Right 1041494853 8:58474401-58474423 ATTGTATTCCTTTTCTGAATGGG No data
1041494851_1041494852 12 Left 1041494851 8:58474365-58474387 CCTATGAGATTCTGGCTTTGCTA No data
Right 1041494852 8:58474400-58474422 TATTGTATTCCTTTTCTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041494851 Original CRISPR TAGCAAAGCCAGAATCTCAT AGG (reversed) Intergenic
No off target data available for this crispr