ID: 1041495683

View in Genome Browser
Species Human (GRCh38)
Location 8:58482967-58482989
Sequence GCCCACTGAGCAATAATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041495683_1041495685 -5 Left 1041495683 8:58482967-58482989 CCTGCCATTATTGCTCAGTGGGC No data
Right 1041495685 8:58482985-58483007 TGGGCTCCGCTCTGTTCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041495683 Original CRISPR GCCCACTGAGCAATAATGGC AGG (reversed) Intergenic
No off target data available for this crispr